Question: conversion binary to ATGC
gravatar for bulbul
3 months ago by
bulbul10 wrote:
CloneID                  Sequence                               CloneID P1  P2  1   2   3   4
11061   TCGCTGTACACTGTTGACGTCGCC        11061   1   1   1   1   1   1
11294   AAAGGTTCTATCTCGCTGAAACCCAG  11294   0   1   1   1   1   1
22912   ACCATCGCTGCACCACCTTGACCT             22912  1   -   1   1   1   1
11324   AGCAGCGTCGACTGCCGAGATCGG            11324   1   1   1   1   1   1
10918   GACGTGGCCGAGATCGGAAGAGC         10918   -   1   1   1   1   1
22617   AGCAGCGGTGTGTCACCATGGGGTG   22617   0   1   1   1   -   1
30239   TACCTCCGAGATCGGAAGAGCGGTTCG 30239   -   1   1   1   1   1
18650   GACTTGCCTGCGCGCCGCC                 18650   1   1   1   1   1   1
10995   TGAAATGCCGTGCATGATTAA               10995   1   1   1   -   1   1
11261   TAGGTTACCTTCCGAGATCGGAAG           11261    1   1   1   1   1   1

This is my DArT example data (it's already in biallelic format). How Should i convert into AT, GC format for each binary digit? Kindly help me. Thanks in advance.

snp gwas • 190 views
ADD COMMENTlink modified 3 months ago by Vijay Lakhujani3.5k • written 3 months ago by bulbul10

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.

Thank you!

ADD REPLYlink written 3 months ago by genomax60k

Hi, Can you please clearly mention which binary digit data belongs to which nucleotide?

ADD REPLYlink written 3 months ago by sangram_keshari120

"0" = Reference allele homozygote, "1"= SNP allele homozygote, "-" = missing. But I do not know to to convert the above example data into AT GC AA CC like. kindly suggest me. thank you.

ADD REPLYlink written 3 months ago by bulbul10

This format is the output from which program? Aren't there any accompanying input / output files? How did you obtain this output?

With the information you provided, it is impossible to help in any way.

ADD REPLYlink written 3 months ago by h.mon22k

I have done it for you this time. However, please follow what genomax told in his comment from next time onwards

ADD REPLYlink written 3 months ago by Vijay Lakhujani3.5k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1948 users visited in the last hour