Question: (Closed) Conversion of binary to ATGC
gravatar for bulbul
4 months ago by
bulbul10 wrote:
CloneID                  Sequence                               CloneID P1  P2  1   2   3   4
11061   TCGCTGTACACTGTTGACGTCGCC        11061   1   1   1   1   1   1
11294   AAAGGTTCTATCTCGCTGAAACCCAG  11294   0   1   1   1   1   1
22912   ACCATCGCTGCACCACCTTGACCT             22912  1   -   1   1   1   1
11324   AGCAGCGTCGACTGCCGAGATCGG            11324   1   1   1   1   1   1
10918   GACGTGGCCGAGATCGGAAGAGC         10918   -   1   1   1   1   1
22617   AGCAGCGGTGTGTCACCATGGGGTG   22617   0   1   1   1   -   1
30239   TACCTCCGAGATCGGAAGAGCGGTTCG 30239   -   1   1   1   1   1
18650   GACTTGCCTGCGCGCCGCC                 18650   1   1   1   1   1   1
10995   TGAAATGCCGTGCATGATTAA               10995   1   1   1   -   1   1
11261   TAGGTTACCTTCCGAGATCGGAAG           11261    1   1   1   1   1   1

This is my DArT example data (it's already in biallelic format). How Should i convert into AT, GC format for each binary digit?

Kindly help me. Thanks in advance.

snp dart gwas • 110 views
ADD COMMENTlink modified 4 months ago by zx87546.5k • written 4 months ago by bulbul10
Please log in to add an answer.
The thread is closed. No new answers may be added.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 992 users visited in the last hour