miRdeep2 mapper error

Question

[nivya.james2016]

Hi all,

I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. I am posting the commands used and the error below

nj@nj2:~/Desktop/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /Desktop/indexed genome/genome -s readscollapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

at least one output file (-s or -t) must be designated

What is the mistake and what should be done?

Thank you

[GenoMax]

Based on the error you need to provide on of the following.

-t species    species being analyzed - this is used to link to
              the appropriate UCSC browser
-s file       File with known miRBase star sequences