Question: miRdeep2 mapper error
0
gravatar for nivya.james2016
10 months ago by
nivya.james20160 wrote:

Hi all,

I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. I am posting the commands used and the error below

nj@nj2:~/Desktop/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /Desktop/indexed genome/genome -s readscollapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

at least one output file (-s or -t) must be designated

What is the mistake and what should be done?

Thank you

mapper.pl mirdeep2 • 244 views
ADD COMMENTlink modified 8 months ago by Biostar ♦♦ 20 • written 10 months ago by nivya.james20160
1

Based on the error you need to provide on of the following.

-t species    species being analyzed - this is used to link to
              the appropriate UCSC browser
-s file       File with known miRBase star sequences
ADD REPLYlink modified 10 months ago • written 10 months ago by genomax70k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 557 users visited in the last hour