miRdeep2 mapper error
0
0
Entering edit mode
3.1 years ago

Hi all,

I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. I am posting the commands used and the error below

nj@nj2:~/Desktop/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p /Desktop/indexed genome/genome -s readscollapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h

at least one output file (-s or -t) must be designated

What is the mistake and what should be done?

Thank you

mirdeep2 mapper.pl • 674 views
ADD COMMENT
1
Entering edit mode

Based on the error you need to provide on of the following.

-t species    species being analyzed - this is used to link to
              the appropriate UCSC browser
-s file       File with known miRBase star sequences
ADD REPLY

Login before adding your answer.

Traffic: 1706 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6