Question: How do I download COG sequence?
0
gravatar for kimsumin94
5 months ago by
kimsumin940
kimsumin940 wrote:

How can I obtain COG sequences? I need somethin like COG0001.fna

EC_O127_159
ATGAGTAAGTCTGAAAAT...

And COG0001.gfa like

EC_O127_159
atgagtaagtctgaaaatctttacagcgcagcgcgcgagctgatccctggcggtgtgaac
tcccctgttcgcgcctttactggcgtgggcggcactccactgtttatcgaaaaagcggac
ggcgcttatctgtacgatgttgatggcaaagcctatatcgattatgtcggttcctggggg
ccgatggtgctgggccataaccatccggcgatccgcaatgccgtgattgaagccgccgag
c...

This is one of the COG that exists in E.coli. Thank you.

sequence • 247 views
ADD COMMENTlink modified 5 months ago by genomax63k • written 5 months ago by kimsumin940

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

ADD REPLYlink written 5 months ago by RamRS20k
0
gravatar for genomax
5 months ago by
genomax63k
United States
genomax63k wrote:

All COG related data is available at this link.

ADD COMMENTlink written 5 months ago by genomax63k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1300 users visited in the last hour