Question: How do I download COG sequence?
0
gravatar for kimsumin94
11 months ago by
kimsumin9410
kimsumin9410 wrote:

How can I obtain COG sequences? I need somethin like COG0001.fna

EC_O127_159
ATGAGTAAGTCTGAAAAT...

And COG0001.gfa like

EC_O127_159
atgagtaagtctgaaaatctttacagcgcagcgcgcgagctgatccctggcggtgtgaac
tcccctgttcgcgcctttactggcgtgggcggcactccactgtttatcgaaaaagcggac
ggcgcttatctgtacgatgttgatggcaaagcctatatcgattatgtcggttcctggggg
ccgatggtgctgggccataaccatccggcgatccgcaatgccgtgattgaagccgccgag
c...

This is one of the COG that exists in E.coli. Thank you.

sequence • 455 views
ADD COMMENTlink modified 11 months ago by genomax71k • written 11 months ago by kimsumin9410

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

ADD REPLYlink written 11 months ago by RamRS24k
0
gravatar for genomax
11 months ago by
genomax71k
United States
genomax71k wrote:

All COG related data is available at this link.

ADD COMMENTlink written 11 months ago by genomax71k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2676 users visited in the last hour