Question: standalone blast output to excel
0
gravatar for shuksi1984
23 months ago by
shuksi198460
shuksi198460 wrote:

I want the standalone blast output in a specific format, which needs to have only aligned sequence the corresponding sequence id . Hence, is it possible to dump standalone blast output to excel?

sequence alignment genome • 844 views
ADD COMMENTlink written 23 months ago by shuksi198460
1

Yes, just use -outfmt 6 or -outfmt 10 for tab or comma separated values and import to excel accordingly. You also need to define the output fields you're interested in. You can see all options with blastn -help

ADD REPLYlink modified 23 months ago • written 23 months ago by 5heikki9.0k

which needs to have only aligned sequence the corresponding sequence id.

Could you please explain more ?

ADD REPLYlink written 23 months ago by Chirag Parsania1.9k

Following should be the content of excel:

Score   Expect  Identities  Gaps    Strand
6.684e+06 bits(3619559)     0.0     3619559/3619559(100%)   0/3619559(0%)   Plus/Plus

Query  1       
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct  1 
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
ADD REPLYlink modified 23 months ago by finswimmer13k • written 23 months ago by shuksi198460

you can indeed (as 5heikki says) get this from the tabular blast output. It might/will require some reformatting though as you will get all on a single line from blast

ADD REPLYlink modified 23 months ago • written 23 months ago by lieven.sterck8.5k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2058 users visited in the last hour