Question: Finding the start codon
0
gravatar for Mimmi Ahlmén
10 months ago by
Mimmi Ahlmén10 wrote:

I'm trying to find the start codon in this set of bases in a gene. I'm totally new in this field so you'll have to forgive my probably very basic question. This is on the reverse strand, so should it be read in the opposite way? I used ACT to find this gene.

>CDS CDS undefined product 93737:94594 reverse
GTGAATTCATTGAATAAAACTGGTCTTCTTTACATTGTTCCAACACCTATTGGAAATTTA
        10        20        30        40        50        60
TCTGATATTACTTATCGAGCTGTAGAAACACTAAAAAATGTTAATTTAATAGCAGCTGAA
        70        80        90       100       110       120
AATATTCATCATACTAATATTTTACTACAACATTACAACGTTAAAAATATTTTAATATCT
       130       140       150       160       170       180
TTAAATAAAAATAATGAAAAAAAACAAAGTGATTATGTAATTAACGAACTAAAAAAAGGA
       190       200       210       220       230       240
AAAAAAATTGCCTTAGTATCTGATGCAGGGACACCAGTTATTAACGATCCAGGTTATTTT
       250       260       270       280       290       300
TTAGTAAAAAAATGCTGTTTTTTAAACATTAAAATCATTCCTCTCCCAGGACCTTGTGCA
       310       320       330       340       350       360
GCTATTACAGCACTGAGTGCTTCTGGAATATCTACTAATCGTTTTTGCTATGAAGGATTT
       370       380       390       400       410       420
CTGCCTTCTAAAAAAAAAATAAGACGTGATTTATTAAAATCTTTAAAAAAAGAAATAAGG
       430       440       450       460       470       480
ACAATAATTTTTTATGAATCGAAACATAGAATACTTGAAAGTATAAAAGATATTATAGAA
       490       500       510       520       530       540
ACAATAGATGAAAATAGATATTTAGTAATCGCAAGAGAAATTACAAAAAAATGGGAGTAT
       550       560       570       580       590       600
ATATACGGTGCAAAAGCTAATATAATTCTGTCTTGGCTGAAAGAAGATCAAAGTCGTTAT
       610       620       630       640       650       660
AAAAAAGGCGAAATAGTAATTATTATAGATGGTTTTAAAGAATTAAAAAATAAAGATATT
       670       680       690       700       710       720
TCAGCAAAAGCAATAAATACATTGACAATCTTAAGAAATTTTCTTTCATTAAAACAATCA
       730       740       750       760       770       780
GTATTTATTACTTCTAAAATACATAAAATAAAAAAAAATGATTTATATCAACATGCAATA
       790       800       810       820       830       840
AAAGAAAAAGATAAGTGA
       850
artemis • 435 views
ADD COMMENTlink modified 10 months ago by caggtaagtat700 • written 10 months ago by Mimmi Ahlmén10

Sequence is generally presented in 5'--> 3' direction no matter what strand it is on (watson/crick). So ATG would still be a start codon (that is a naive generalization). Generally decreasing coordinates are used to indicate that the sequence is from reverse strand.

ADD REPLYlink modified 10 months ago • written 10 months ago by genomax70k

OK, thanks! So in this case the start codon is GTG? I used GenemarkS to predict this ORF.

ADD REPLYlink written 10 months ago by Mimmi Ahlmén10
1

Yes, ATG is not the only valid start codon.

ADD REPLYlink written 10 months ago by jrj.healey13k
0
gravatar for caggtaagtat
10 months ago by
caggtaagtat700
caggtaagtat700 wrote:

Hi, I also think its the correct way, since there is a stopcodon TGA at the end. Therefore per definition of a CDS sequence, the GTG would be your start codon, which could be for example the case, if this is a gene from E.coli.

ADD COMMENTlink written 10 months ago by caggtaagtat700
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 660 users visited in the last hour