Question: read strand identification from sam file
gravatar for alireza346
3 months ago by
alireza3460 wrote:

I have sam files (aligned RNAseq to genome) and converted the bam files to sam file. I am working with python. in my pipeline I need to know the strand of the reads. the following lines are 2 examples of the reads that I have in my sam file:

D00645:305:CCVLRANXX:1:1104:13111:49466 272 chr1    35222   0   31M *   0   0   CAAGTGTTTAGAGCTTAATCGTGTTCAAAAT GGGGGGCCGFGGGGC<0F>BGF1F/BEGGGG AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i :0 NM:i:0  MD:Z:31 YT:Z:UU NH:i:6  CC:Z:chr12  CP:i:68440  HI:i:0

D00645:305:CCVLRANXX:1:2203:2308:37794  272 chr1    35222   0   31M *   0   0   CAAGTGTTTAGAGCTTAATCGTGTTCAAAAT GGGEGGGGGGGGGGGGGGGGGEGGGGGGGGG AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:31 YT:Z:UU NH:i:6  CC:Z:chr12  CP:i:68440  HI:i:0

do you know how I can identify the strand of these 2 reads. I actually looked it up but did not find any solution.

rna-seq alignment • 221 views
ADD COMMENTlink modified 3 months ago by Pierre Lindenbaum116k • written 3 months ago by alireza3460
gravatar for Pierre Lindenbaum
3 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum116k wrote:

in second column : samflag 172 -> -> read is UNMAPPED (while its' mate is mapped on reverse strand )

in second column : samflag 272 -> -> read reverse strand

ADD COMMENTlink modified 3 months ago • written 3 months ago by Pierre Lindenbaum116k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1141 users visited in the last hour