mirdeep2 v 10
0
0
Entering edit mode
5.7 years ago

I running mirdeep2 mapper.pl using this script:

/Users/sysadmin/desktop/mirdeep2-0.1.0/src/mapper.pl obese_miRNAseq_config.txt -d -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ../hg19.ebwt/hg19 -q -s all_obese_miRNA_reads.fa -t all_obese_miRNA_reads_vs_hg19.arf -v

but i get a message: Cannot open FASTQ file supplied by option -e

Anybody with an idea what's going on?

RNA-Seq • 1.5k views
ADD COMMENT
0
Entering edit mode

Output of head all_obese_miRNA_reads.fa?

ADD REPLY
0
Entering edit mode

No, this is not the out put file. I am running mapper.pl

ADD REPLY
0
Entering edit mode

I am first running mapper.pl, so I can generate the .fa output for the quantifier.pl

ADD REPLY
0
Entering edit mode

ATPoint asked for the output of a command, he was not referring to the fasta file as the output file.

ADD REPLY
0
Entering edit mode

It seems -e expects a fastq file, and you supplying none.

ADD REPLY
0
Entering edit mode

Yeah, that is why it should be checked if the file is indeed fasta or just mis-suffixed.

ADD REPLY
0
Entering edit mode

I have fastq files compiled into a config.tx file. I have included option -d and -e

ADD REPLY
0
Entering edit mode

Below is the format for the fastq that I have:

+
#11BDFFFHHHHHIIIIIIIGGFHIGGIHHIHIIIIIIHGHIIIIIHHFF
@SN7001386:168:HJVLWBCX2:1:1101:2505:1973 1:N:0:ATCACG
NGCTACCTCGTACGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGA
ADD REPLY
0
Entering edit mode

Can you check the config.txt file?

It should be in the below format (make sure, you provide space in between fastq file and sample name)

Sample1.fastq Sample1
Sample2.fastq Sample2
Sample3.fastq Sample3
ADD REPLY
0
Entering edit mode

what's the unix command to open fasta file?

ADD REPLY
0
Entering edit mode

Do not add an answer unless you're answering the top level question; Use the Add Comment or Add Reply options instead. I'm moving this to a comment.

Please google "unix command to view file" and show us you've invested some effort.

ADD REPLY

Login before adding your answer.

Traffic: 3615 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6