Bulk primer design
3
1
Entering edit mode
2.9 years ago
ATCG ▴ 350

Given a FASTA sequence, how can I design primers specifying the desired number of primers and a distance? e.g Generate 100 primers every 500bp. Thank you!

primers bulk FASTA kmer • 1.0k views
ADD COMMENT
0
Entering edit mode

primers for what ? pcr ? why is your post labelled with kmers ?

ADD REPLY
1
Entering edit mode
2.9 years ago
ATpoint 55k

Without more details, I assume standard PCR as application. I would start by cutting the fasta into equal (and maybe overlapping) chunks representing the amplicons you want, e.g. using shred.sh from BBmap, see command-line tool to split genome FASTA into equal chunks?, and then use the command line version of Primer3 to design the primers. Manual for primer3 is also on Github, with plenty of options to customize your search.

ADD COMMENT
1
Entering edit mode
2.9 years ago
Joe 19k

Funnily enough, I just started writing something to do exactly this yesterday. It's still a work in progress, but so far is has the basic functionality of reading in a selection of fasta target sequences, and giving back primers that span either end of the sequence of a defined length.

Primer3 etc are much more mature though, so you might want to try them.

Here's a link to my project anyway:

https://github.com/jrjhealey/PrYmer

ADD COMMENT
0
Entering edit mode

This looks really interesitng, did your project reach final stages? can the tool be used right now?

ADD REPLY
0
Entering edit mode

It's functional, I wouldn't call it 'finished' (I'm not sure it ever will be as I keep adding things to it as I use it).

It can do the basics though. Feel free to experiment with it and request features though.

ADD REPLY
1
Entering edit mode
2.9 years ago

linearize the fasta , split the fasta using a sliding window with awk (or see Fasta Sliding Window ), convert to primer3 input with awk, pipe into primer3.

awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' input.fasta  |\
awk -F '\t' '{L=length($2);W=500;S=100;for(i=1;i+W<=L;i+=S) {printf("PRIMER_THERMODYNAMIC_PARAMETERS_PATH=/your/path/to/primer3_config/\nSEQUENCE_ID=seq%d.%d\nSEQUENCE_TEMPLATE=%s\n=\n",NR,i,substr($2,i,W));}}' | \
/path/to/primer3-2.3.5/src/primer3_core

SEQUENCE_ID=seq1.1
SEQUENCE_TEMPLATE=GTTGATGCTCGAGATGGAGTCTACTCAGCAGATGGTGGGTTCTATTATCAACACTTCTTTTGAAGCCGCAGTTGTTGCTGCCACTTCAACATTAGAATTGATGGGTATTCAATATGATTATAATGAAGTTTTCACTAGAGTAAAGAGTAAATTTGATTATGTA(...)
PRIMER_LEFT_NUM_RETURNED=5
PRIMER_RIGHT_NUM_RETURNED=5
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=5
PRIMER_PAIR_0_PENALTY=0.899912
PRIMER_LEFT_0_PENALTY=0.864455
PRIMER_RIGHT_0_PENALTY=0.035458
PRIMER_LEFT_0_SEQUENCE=GCTGCGACTATTGATCAGGC
PRIMER_RIGHT_0_SEQUENCE=CTTCAACTTCCCCACGCTCT
PRIMER_LEFT_0=202,20
PRIMER_RIGHT_0=463,20
PRIMER_LEFT_0_TM=59.136
PRIMER_RIGHT_0_TM=59.965
PRIMER_LEFT_0_GC_PERCENT=55.000
PRIMER_RIGHT_0_GC_PERCENT=55.000
PRIMER_LEFT_0_SELF_ANY_TH=0.08
PRIMER_RIGHT_0_SELF_ANY_TH=0.00
PRIMER_LEFT_0_SELF_END_TH=0.00
PRIMER_RIGHT_0_SELF_END_TH=0.00
PRIMER_LEFT_0_HAIRPIN_TH=0.00
PRIMER_RIGHT_0_HAIRPIN_TH=0.00
PRIMER_LEFT_0_END_STABILITY=4.8500
PRIMER_RIGHT_0_END_STABILITY=4.0900
PRIMER_PAIR_0_COMPL_ANY_TH=0.00
PRIMER_PAIR_0_COMPL_END_TH=0.00
PRIMER_PAIR_0_PRODUCT_SIZE=262
(...)
=
SEQUENCE_ID=seq1.101
SEQUENCE_TEMPLATE=ATGGGTATTCAATATGATTATAATGAAGTTTTCACTAGAGTAAAGAGTAAATTTGATTATGTAATGGATGATTCTGGTGTAAAAAATAATCTCTTAGGTAAAGCTGCGACTATTGATCAGGCTTTAAACGGAAAGTTTGCTTCAGTGATAAGAAATAGAAATT(...)
PRIMER_LEFT_NUM_RETURNED=5
PRIMER_RIGHT_NUM_RETURNED=5
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=5
PRIMER_PAIR_0_PENALTY=0.899912
PRIMER_LEFT_0_PENALTY=0.864455
PRIMER_RIGHT_
ADD COMMENT

Login before adding your answer.

Traffic: 2473 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6