Question: Bulk primer design
1
gravatar for  DataFanatic
18 months ago by
DataFanatic220
DataFanatic220 wrote:

Given a FASTA sequence, how can I design primers specifying the desired number of primers and a distance? e.g Generate 100 primers every 500bp. Thank you!

kmer primers bulk fasta • 598 views
ADD COMMENTlink modified 18 months ago by Pierre Lindenbaum128k • written 18 months ago by DataFanatic220

primers for what ? pcr ? why is your post labelled with kmers ?

ADD REPLYlink written 18 months ago by Pierre Lindenbaum128k
1
gravatar for ATpoint
18 months ago by
ATpoint35k
Germany
ATpoint35k wrote:

Without more details, I assume standard PCR as application. I would start by cutting the fasta into equal (and maybe overlapping) chunks representing the amplicons you want, e.g. using shred.sh from BBmap, see command-line tool to split genome FASTA into equal chunks?, and then use the command line version of Primer3 to design the primers. Manual for primer3 is also on Github, with plenty of options to customize your search.

ADD COMMENTlink modified 18 months ago • written 18 months ago by ATpoint35k
1
gravatar for Joe
18 months ago by
Joe16k
United Kingdom
Joe16k wrote:

Funnily enough, I just started writing something to do exactly this yesterday. It's still a work in progress, but so far is has the basic functionality of reading in a selection of fasta target sequences, and giving back primers that span either end of the sequence of a defined length.

Primer3 etc are much more mature though, so you might want to try them.

Here's a link to my project anyway:

https://github.com/jrjhealey/PrYmer

ADD COMMENTlink written 18 months ago by Joe16k

This looks really interesitng, did your project reach final stages? can the tool be used right now?

ADD REPLYlink written 2 days ago by tarekzakaria.badr30

It's functional, I wouldn't call it 'finished' (I'm not sure it ever will be as I keep adding things to it as I use it).

It can do the basics though. Feel free to experiment with it and request features though.

ADD REPLYlink written 2 days ago by Joe16k
1
gravatar for Pierre Lindenbaum
18 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum128k wrote:

linearize the fasta , split the fasta using a sliding window with awk (or see Fasta Sliding Window ), convert to primer3 input with awk, pipe into primer3.

awk '/^>/ {printf("%s%s\t",(N>0?"\n":""),$0);N++;next;} {printf("%s",$0);} END {printf("\n");}' input.fasta  |\
awk -F '\t' '{L=length($2);W=500;S=100;for(i=1;i+W<=L;i+=S) {printf("PRIMER_THERMODYNAMIC_PARAMETERS_PATH=/your/path/to/primer3_config/\nSEQUENCE_ID=seq%d.%d\nSEQUENCE_TEMPLATE=%s\n=\n",NR,i,substr($2,i,W));}}' | \
/path/to/primer3-2.3.5/src/primer3_core

SEQUENCE_ID=seq1.1
SEQUENCE_TEMPLATE=GTTGATGCTCGAGATGGAGTCTACTCAGCAGATGGTGGGTTCTATTATCAACACTTCTTTTGAAGCCGCAGTTGTTGCTGCCACTTCAACATTAGAATTGATGGGTATTCAATATGATTATAATGAAGTTTTCACTAGAGTAAAGAGTAAATTTGATTATGTA(...)
PRIMER_LEFT_NUM_RETURNED=5
PRIMER_RIGHT_NUM_RETURNED=5
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=5
PRIMER_PAIR_0_PENALTY=0.899912
PRIMER_LEFT_0_PENALTY=0.864455
PRIMER_RIGHT_0_PENALTY=0.035458
PRIMER_LEFT_0_SEQUENCE=GCTGCGACTATTGATCAGGC
PRIMER_RIGHT_0_SEQUENCE=CTTCAACTTCCCCACGCTCT
PRIMER_LEFT_0=202,20
PRIMER_RIGHT_0=463,20
PRIMER_LEFT_0_TM=59.136
PRIMER_RIGHT_0_TM=59.965
PRIMER_LEFT_0_GC_PERCENT=55.000
PRIMER_RIGHT_0_GC_PERCENT=55.000
PRIMER_LEFT_0_SELF_ANY_TH=0.08
PRIMER_RIGHT_0_SELF_ANY_TH=0.00
PRIMER_LEFT_0_SELF_END_TH=0.00
PRIMER_RIGHT_0_SELF_END_TH=0.00
PRIMER_LEFT_0_HAIRPIN_TH=0.00
PRIMER_RIGHT_0_HAIRPIN_TH=0.00
PRIMER_LEFT_0_END_STABILITY=4.8500
PRIMER_RIGHT_0_END_STABILITY=4.0900
PRIMER_PAIR_0_COMPL_ANY_TH=0.00
PRIMER_PAIR_0_COMPL_END_TH=0.00
PRIMER_PAIR_0_PRODUCT_SIZE=262
(...)
=
SEQUENCE_ID=seq1.101
SEQUENCE_TEMPLATE=ATGGGTATTCAATATGATTATAATGAAGTTTTCACTAGAGTAAAGAGTAAATTTGATTATGTAATGGATGATTCTGGTGTAAAAAATAATCTCTTAGGTAAAGCTGCGACTATTGATCAGGCTTTAAACGGAAAGTTTGCTTCAGTGATAAGAAATAGAAATT(...)
PRIMER_LEFT_NUM_RETURNED=5
PRIMER_RIGHT_NUM_RETURNED=5
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=5
PRIMER_PAIR_0_PENALTY=0.899912
PRIMER_LEFT_0_PENALTY=0.864455
PRIMER_RIGHT_
ADD COMMENTlink modified 18 months ago • written 18 months ago by Pierre Lindenbaum128k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 853 users visited in the last hour