mirDeep2 mapping error
1
0
Entering edit mode
3.2 years ago

Hi all,

Kindly help me with this issue

shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h
parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt

I have used bowtie version 1. But i dont know why this is occuring.

Thank You in advance

mirdeep2 mapper.pl • 999 views
ADD COMMENT
0
Entering edit mode

Please add the command you used to generate the genome index with bowtie 1

Could not locate a Bowtie index corresponding to basename "genome"

ADD REPLY
0
Entering edit mode

i used the command to generate bowtie files

bowtie-build genome.fa genome
ADD REPLY
0
Entering edit mode

Do you have a directory called genome with .ebwt files inside ?

Could you copy paste the log file of the bowtie-build command please

ADD REPLY
0
Entering edit mode

yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the mapper.pl function there is a bowtie log file. Kindly check these files

Could not locate a Bowtie index corresponding to basename "genome"
Command: bowtie -p 1 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata --al dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_mapped --un dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_not_mapped genome dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/reads_nr.fa dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/mappings.bwt
ADD REPLY
0
Entering edit mode

Please make sure the index name which you have provided during bowtie-build is same as what you are providing after '-p' option.

ADD REPLY
0
Entering edit mode

Yes. i checked again. It is the same index name that i have provided after -p option.

ADD REPLY
2
Entering edit mode
3.2 years ago

Is the genome index directory in your current path (~/) ? Otherwise you should had the absolut path of the genome index directory in your command line.

ADD COMMENT
0
Entering edit mode

Ok. I shall check it. Thank you so much.

ADD REPLY
0
Entering edit mode

Thank You so much Bastein i was able to get the results when done like you suggested.

ADD REPLY

Login before adding your answer.

Traffic: 1931 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6