Question: mirDeep2 mapping error
0
gravatar for nivya.james2016
23 months ago by
nivya.james20160 wrote:

Hi all,

Kindly help me with this issue

shanthi@shanthi-client2:~/Desktop/Nivya/Fastq files/SRR7189567-stage 1A$ mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT  -l 18 -m -p genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -v -n -h
parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
Could not locate a Bowtie index corresponding to basename "genome"
Please make sure you used bowtie version 1 to build the index.
Usual index files have suffix .ebwt

I have used bowtie version 1. But i dont know why this is occuring.

Thank You in advance

mapper.pl mirdeep2 • 622 views
ADD COMMENTlink modified 22 months ago by Biostar ♦♦ 20 • written 23 months ago by nivya.james20160

Please add the command you used to generate the genome index with bowtie 1

Could not locate a Bowtie index corresponding to basename "genome"

ADD REPLYlink modified 23 months ago • written 23 months ago by Bastien Hervé4.8k

i used the command to generate bowtie files

bowtie-build genome.fa genome
ADD REPLYlink modified 23 months ago • written 23 months ago by nivya.james20160

Do you have a directory called genome with .ebwt files inside ?

Could you copy paste the log file of the bowtie-build command please

ADD REPLYlink written 23 months ago by Bastien Hervé4.8k

yes i do have genome directory with .ebwt files.. but there are no log files other than .ebwt files inside. but after doing the mapper.pl function there is a bowtie log file. Kindly check these files

Could not locate a Bowtie index corresponding to basename "genome"
Command: bowtie -p 1 -f -n 0 -e 80 -l 18 -a -m 5 --best --strata --al dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_mapped --un dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/trim_3_SRR7189567.fastq_not_mapped genome dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/reads_nr.fa dir_mapper_seq_trim_3_SRR7189567.fastq_9694215930_29_11_2018_t_12_44_40/mappings.bwt
ADD REPLYlink written 23 months ago by nivya.james20160

Please make sure the index name which you have provided during bowtie-build is same as what you are providing after '-p' option.

ADD REPLYlink written 23 months ago by toralmanvar900

Yes. i checked again. It is the same index name that i have provided after -p option.

ADD REPLYlink written 23 months ago by nivya.james20160
2
gravatar for Bastien Hervé
23 months ago by
Bastien Hervé4.8k
Karolinska Institutet, Sweden
Bastien Hervé4.8k wrote:

Is the genome index directory in your current path (~/) ? Otherwise you should had the absolut path of the genome index directory in your command line.

ADD COMMENTlink written 23 months ago by Bastien Hervé4.8k

Ok. I shall check it. Thank you so much.

ADD REPLYlink written 23 months ago by nivya.james20160

Thank You so much Bastein i was able to get the results when done like you suggested.

ADD REPLYlink written 22 months ago by nivya.james20160
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 855 users visited in the last hour