Question: EzBioCloud for contamination of Illumina raw files
0
gravatar for eozcan
22 months ago by
eozcan10
eozcan10 wrote:

Hi,

Anybody used ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences from EZBiocloud for Illumina files? It gives error when I upload fasta file reads from Illumina. I unzip files and convert them to fasta. It says something went wrong in a webpage error.

sequencing rna-seq • 1.6k views
ADD COMMENTlink modified 22 months ago by genomax91k • written 22 months ago by eozcan10

I'd naively assume it expects a fastq file, rather than a fasta file. Can you add a link?

ADD REPLYlink written 22 months ago by WouterDeCoster44k

here is the link. I tried fastq format, it reject that format from the beginning. https://www.ezbiocloud.net/tools/contest16s

ADD REPLYlink written 22 months ago by eozcan10

I see, the page clearly says fasta format.

It says something went wrong in a webpage error.

Perhaps you could be a bit more specific here.

ADD REPLYlink written 22 months ago by WouterDeCoster44k

I tried to upload a fasta concatenated file from my Illumina pair-end reads, it says "something went wrong displaying the webpage."

ADD REPLYlink written 22 months ago by eozcan10

Can you show us a few lines of your fasta file, and please add the commands you used to make the file.

ADD REPLYlink written 22 months ago by WouterDeCoster44k
>NS500540:135:HFF77AFXY:1:11101:6499:1061 1:N:0:ATTACTCG+NGGATAGG
GGCATTACTTCGGGGTAGGTCTTAAATAAGAGCGCAATGTTGGTATAGGCTCCCGTTGGCACTAACGTAATCGGT
>NS500540:135:HFF77AFXY:1:11101:23445:1062 1:N:0:ATTACTCG+NGGATAGG
CGCGTTTAAAACTTGGGAATGTCTTCGTAACAGACATGCACCTCCGTTTAAACTTTGTAATACCTGAGTCTACAA
>NS500540:135:HFF77AFXY:1:11101:3974:1062 1:N:0:ATTACTCG+NGGATAGG

This is raw illumina reads concatenated using

cat eo1_S17_L001_R2_001.fastq.gz eo1_S17_L002_R2_001.fastq.gz eo1_S17_L003_R2_001.fastq.gz eo1_S17_L004_R2_001.fastq.gz > eo1_R2.fastq.gz

Then, I used fastxtoool kit to convert from fastq to fasta

ADD REPLYlink modified 22 months ago by WouterDeCoster44k • written 22 months ago by eozcan10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 995 users visited in the last hour