Question: STAR alignment error: ERROR in input reads
0
gravatar for prabin.dm
10 days ago by
prabin.dm30
prabin.dm30 wrote:

Hi,

I am using STAR to align my RNAseq datasets and I am having this error

ReadAlignChunk_processChunks.cpp:115:processChunks EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >

This is my code

module load star/2.5.3a

STAR -- genomeDir mouse/star_genome_mm10 \
        -- readFilesIn L001_R1_001.fastq.gz \
        --outSAMtype BAM SortedByCoordinate \
        --outSAMunmapped Within \
        --twopassMode Basic \
        --outFilterMultimapNmax 1 
        --quantMode TranscriptomeSAM \
        --runThreadN 6 \
        --outFileNamePrefix "STAR_output/Test/"

The Fastq files look like this

@NS500540:133:HNFTLBGX5:1:11101:11802:1042 1:N:0:ACTGAT
CTCCGNTTTATTTATTTGTTCTGCAAATTCGATGCGTCTACCTTCAAATAAAGCATTCATCTTTCTCTGTGACTCT
+
AAAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Is there something wrong I am not able to figure out? I have checked the file for each line, they start with @

thank you

rna-seq star fastq • 172 views
ADD COMMENTlink modified 9 days ago • written 10 days ago by prabin.dm30
1

I have checked the file for each line, they start with @

Are you certain about that? Did you do anything to this file that may have corrupted the format (e.g. improper trimming)?

You can try validateFiles utility from Jim Kent to see if your file checks out.

ADD REPLYlink modified 10 days ago • written 10 days ago by genomax59k

Thats looks like an useful utility.

When I downloaded it saves as a text file, which I cant run. Can you please let me know how to use it?

ADD REPLYlink written 9 days ago by prabin.dm30

You need to add execute permission to it by doing chmod a+x validateFiles before you can run it.

ADD REPLYlink written 9 days ago by genomax59k
1

There shouldn't be a space in -- readFilesIn. Please select a title which describes your problem better than this.

ADD REPLYlink modified 9 days ago • written 9 days ago by WouterDeCoster35k

thank you. I will make that change. Also, I changed the title.

ADD REPLYlink written 9 days ago by prabin.dm30

what are the outputs of

file L001_R1_001.fastq.gz

and

gunzip -c L001_R1_001.fastq.gz | paste - - - - | cut -c 1 | uniq | sort | uniq

?

ADD REPLYlink written 10 days ago by Pierre Lindenbaum115k

the output for file L001_R1_001.fastq.gz is L001_R1_001.fastq.gz: gzip compressed data, extra field

and the output for gunzip -c L001_R1_001.fastq.gz | paste - - - - | cut -c 1 | uniq | sort | uniq is @

ADD REPLYlink written 10 days ago by prabin.dm30
6
gravatar for h.mon
10 days ago by
h.mon21k
Brazil
h.mon21k wrote:

If your fastq files are gzip-compressed, you have to use the parameter --readFilesCommand zcat.

ADD COMMENTlink written 10 days ago by h.mon21k

That worked. Thank you

While we are at it, can i ask another question?

I prepared STAR genome indices with --sjdbOverhang 99. Currently the readlength of my fastq files are 75bp.

Should I prepare genome indices again ?

ADD REPLYlink written 9 days ago by prabin.dm30
2

Biostars is better organized if each thread has only one question. Anyway, no, you do not need to build the indices again, see this post: Confused about sjdbOverhang .

ADD REPLYlink written 9 days ago by h.mon21k

Thanks again. I will do that.

ADD REPLYlink written 9 days ago by prabin.dm30
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 722 users visited in the last hour