Need help finding a primer for a sequence

Question

[sagar]

Hello everyone, I am trying to insert my cDNA sequence into a plasmid.

I need help finding a primer or making a primer for this cDNA at a temperature between 52 and 54 degrees C.:

actaggatggtgcgcggcattcgcggcgcgattaccgtggaagaagataccccggaagcgattcat caggcgacccgcgaactgctgctgaaaatgctggaagcgaacggcattcagagctatgaa gaactggcggcggtgatttttaccgtgaccgaagatctgaccagcgcgtttccggcggaa gcggcgcgccagattggcatgcatcgcgtgccgctgctgagcgcgcgcgaagtgccggtg ccgggcagcctgccgcgcgtgattcgcgtgctggcgctgtggaacaccgataccccgcag gatcgcgtgcgccatgtgtatctgcgcgaagcggtgcgcctgcgcccggatctggaaagcgcgcagaattc

The bolded regions are my restriction enzymes EcoR1 and EcoN1. Does anyone know a simple way to make a primer for this?

Answer 1

[JC]

Use Primer3, here are some webservers:

• http://primer3.ut.ee/
• https://primer3plus.com/

Answer 2

[ATpoint]

Often when you have a sequence with strictly defined starts and ends, you will not find an optimal primer according to what tools like Primer3/Primer-BLAST define as optimal. Primer3 is a good choice if you give it a region and let it allow to set primers to get products in a certain bp range, but in my experience, they do not work well if you force them to amplify a strictly defined stretch of DNA. For these situations, I manually load the sequence into SnapGeneViewer and search for primers by hand, see here, following the standard rules. So similar Tm, similar length, similar GC content (if possible, not a must), G/Cs at the 3' ends but not more than three. Tm should be within a normal range. Make sure to use tools like the Tm calculator from NEB to see what the annealing temperature for your primer pair would be. Tm in water does not matter as Tm is highly dependent on the polymerase buffer you are going to use. Only the Tm in the buffer is what matters. In case you need cloning overhangs, simply add then to the 5' of the primer. Use BLAST to check if the primer pair produces off-target products with similar sizes than the target band. Off-targets are acceptable as long as you can clearly separate the off-band on a gel, so that you can cleanly cut out the target band. Also make sure that the PCR product does not contain the restriction sites you intend to use. If it does, check out restriction-free cloning with e.g. InFusionHD or NEBuilder HiFi. If for whatever reason you cannot get a primer or you simply don't get a product in the PCR, think about gene synthesis. It is not too expensive and may save you quiet some time.

For your cDNA, I would go with the primer pair below (did not BLAST them though). I personally like KAPA HiFi HotStart polymerase. Tm is in my experience similar or a bit higher than what the NEB Tm tool calculates for its Q5 Master Mix, so for the pair above, anneal at like 70°C:

fwd atggtgcgcggcattcgc
rev ctgcgcgctttccagatcc