Question: Trimmomatic confirmation, multiple indeces per sample?!
0
gravatar for T_18
5 weeks ago by
T_1820
T_1820 wrote:

Hi!

I received my HiSeq Illumina RNAseq data and want to run trimmomatic to remove bad quality reads and trim adapters. I have used trimmomatic before but I am currently in doubt if I create the adapter file in a correct way given the fact that I received multiple indeces per sample, can someone please correct me if I'm wrong?

Sequencing happened on Illumina HiSeq4000 using NEBnext kit for the library construction.

From the sequencing facility I have received the adapter and index sequences (e.g for my first sample):

Adapter:

5' Adapter: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

3' Adapter(lowercase 6bp bases is Index) 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACatcacgATCTCGTATGCCGTCTTCTGCTTG-3

index: CTGGCATA;CGGCTATG

  • I do not understand why I receive two indexes for a single sample? A single sample, needs only one adapter with one specific index? Correct?

  • Trimmomatic needs an adapter file and I will create as follows (with all adapters and indeces in a single file):


>Prefix_AdapterPE1/1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Prefix_AdapterPE1/2
GATCGGAAGAGCACACGTCTGAACTCCAGTCACctggcataATCTCGTATGCCGTCTTCTGCTTG

With the index in capitals also, but just to show that I will manually add the index sequence. I will do this for all received index sequences, added to a single adapter file and will finally run Trimmomatic.

Any comments are welcome!

trimming rnaseq trimmomatic • 79 views
ADD COMMENTlink modified 5 weeks ago by finswimmer8.9k • written 5 weeks ago by T_1820
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 771 users visited in the last hour