Question: MUGSY not able to perform alignment ?
0
gravatar for sunnykevin97
11 weeks ago by
sunnykevin9710
sunnykevin9710 wrote:

Here, I tried to align Chr24 of much closer genomes of elephants it is able to generate a MAF. But, I was expecting an alignment that is gene by gene, and only including the coding regions. CMD

./mugsy --directory /home/Downloads/mugsy/mugsy_x86-64-v1r2/ --prefix mychr  /home/Documents/chr24/chr24.fa /home/Documents/chr24/testReadGroups.bam_CHr24_GATK1.vcf.fa /home/Documents/chr24/test1_Ddedup_2_ReadGroups_chr24.bam_GATK.vcf.fa

The output looks like this, not able to interpret the result.

##maf version=1 scoring=mugsy
a score=1512771 label=1 mult=3
s chr24.LoxArf        5053396 1487445 + 27123610 TGGTGTGTTGAAGTCTCCTACTATAATTGTGGAGGTATCTATCTCACTTTTCAATTCTGTTAAAATTTGATTTATGTATCTTGCAGCCCTGTCATTGGGTGCATAAATATTTAA
TATGGTTATGTCTTCCTGGTCAATTGTCCCTTTTATCATTATATAGTGTCCTTCTTTATCCTTTGTGGTGGATTTAAGTCTAAAGTCTATTTTGTCAGAAATTAATATTGCTACTCCTCTTCTTTTTTGCTTATTGTTTGCTTGATATACTTTTTTCCATCCTTT
GAGTTTTAGTTTGTTTGTGTCTCTAAGTCTAAGGTGTGTCTCTTGTAGGCAGCATATAGATGGATCGTGTTTCTTTATCCAGTCTGTGACTCTCTGTCTCTTTATTGGTGCATTTAGTCCATTTACATTCAGGGTAATTATAGATAAATAAGTTTTTAGTGCTGTCATTGTGATGCCTTTTTATGTGTGTTGTTGACAATTTCATTTTTCCACATA

Mugsy, can handle sequences from closely related genomes. Is their any other alignment tools which generates alignment in MAF (Multiple alignment format). And which are able to align much more distant genomes ?

Thanks!

snp alignment • 232 views
ADD COMMENTlink modified 11 weeks ago by WouterDeCoster37k • written 11 weeks ago by sunnykevin9710

I added code markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLYlink written 11 weeks ago by WouterDeCoster37k

From the manual:

Mugsy is a multiple whole genome aligner.

Mugsy aligns whole chromosomes / genomes, it won't output a gene by gene alignment. If you want a gene by gene alignment, you should look at orthology software - but you have to predict the genes first.

ADD REPLYlink modified 11 weeks ago • written 11 weeks ago by h.mon24k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1625 users visited in the last hour