Question: What is the reference snp and alternative snp in dbsnp window?
0
gravatar for sjunlee89
5 days ago by
sjunlee890
sjunlee890 wrote:

When I searched SNP "rs2976396" in dbsnp and the result is below.

rs2976396 [Homo sapiens]
GTGGACTGAGTAGAACTGGAGGACA[A/G]GAGTCGACGTGAGTTCCTGGGAGTC

Alleles G>A

What is the reference SNP and alternative SNP?

I would like to know how to interpret this.

Thanks advanced.

snp tool • 91 views
ADD COMMENTlink modified 5 days ago by ATpoint12k • written 5 days ago by sjunlee890
3
gravatar for ATpoint
5 days ago by
ATpoint12k
Germany
ATpoint12k wrote:

G is the reference allele and A the alternative allele. G is changed into A, which is represented by G>A. The allele frequences (how often does this particular genotype occur in the studies population) is also indicated on dbSNP.

ADD COMMENTlink modified 5 days ago • written 5 days ago by ATpoint12k

Thank you for your reply!

ADD REPLYlink written 5 days ago by sjunlee890
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1092 users visited in the last hour