Entering edit mode
5.2 years ago
misterie
▴
110
Hi,
During run pbalign, I see that pbalign does not produce output. I tried different options — print to stdout, to file, by tmp files and that only creates empty file. It seems that pbalign (0.3.2) does not align my files. I also tried to run blasr and there is the same problem.
The command is:
pbalign 1529-13.subreads.bam ../Canu/1529-13/1529-13.contigs.fasta ../pbalign/1529-13/1529-13.aligned.bam
Head of 1529-13.subreads.bam is (after converting to sam):
m171229_125441_42242_c101415532550000001823309602281896_s1_p0/133/0_4918 4 * 0 255 * * 0 0
CGAGAGAGACACGCGCGGGTGGCGGGAATGGGCGTAAAACTACTGCTATGTAGTGAGCTTGTAGCGATTCAATTTCTGGTGCCCACAGAGAACAGTCCTGCCATGAAAAACCCGTCGCACGCTAAAATCATCACCTGGTGACCAGTTCCGCATTGAAAGCGGAAGATAGACGTTGGAAGACAAATAGAATAAAAATGACATATGGGCTGTGCTTAGGGCAAACACAAGGGAGGAAAACCGAAAGTTATGCAAAGCAAAGATTGCCTTAGACAATCAGCACATTGCATTA
head of ../Canu/1529-13/1529-13.contigs.fasta:
>tig00000001 len=4788647 reads=8296 covStat=6586.98 gappedBases=no class=contig suggestRepeat=no suggestCircular=yes
AAACCCGCGCGGCTTCTCGCTCAGATGTAATGGTGCGCTGATACCAACATAGGCTGCTTCCTGACTAAAAATAAACGTCTCCTGAATATGTGCAGCACAA
GTCCGGAAAAGGTAAAAGCAGCGGGCAAGTTTGTGCAAAAATCATGCAAAAAAGGAGAGCCTGTCGCTCTCCTGATTTTTAGTACTCCGAGTTGACAATG
ATTTCCTCGCCAAACGCGCCTGCCTGCGGCAGCGGTTTGTAAGTGGAGTTAGCGGCGCGCAGGATGCGAATACCG
Please paste the exact commands you used, as well as the first few lines of your input file.
The command is:
Head of
1529-13.subreads.bamis (after converting to sam):head of
../Canu/1529-13/1529-13.contigs.fasta:Please edit your question and add this in there. Once that's done, you can delete your comment. This is so people would not need to read through sub-conversations to understand the premise of the top-level post.
Do you able to fix this issue?