Question: How to dissolve blastn alignment result predicted locally
0
gravatar for Neu
7 months ago by
Neu10
India
Neu10 wrote:

Hi, I have predicted RNA-RNA interaction using blastn locally with the option strand=both. How can I dissolve the output file (as described below) to get RNA pairs with specifications: strand plus/minus, 95% identity and minimum length 25. (I do have a result in tabular format obtained by using outfmt 6, but that does not have both stand information.)

Query= chr1:1080738-1080845

Length=107

Sequences producing significant alignments:       Score     E                   (Bits)  Value

ENST00000367311.4     36.2    0.22  
ENST00000368686.1     34.4    0.79  
ENST00000397906.6    32.5    2.8  
ENST00000612946.4    32.5    2.8  
ENST00000614107.4   32.5    2.8  
ENST00000304166.8    32.5    2.8  


>ENST00000367311.4 
Length=2640

 Score = 36.2 bits (19),  Expect = 0.22
 Identities = 22/23 (96%), Gaps = 1/23 (4%)
 Strand=Plus/Plus

Query  56    TCGGCCATGAAGGTGGTGGGGGT  78
             |||||| ||||||||||||||||
Sbjct  1435  TCGGCC-TGAAGGTGGTGGGGGT  1456


>ENST00000368686.1 
Length=2250

 Score = 34.4 bits (18),  Expect = 0.79
 Identities = 18/18 (100%), Gaps = 0/18 (0%)
 Strand=Plus/Minus
blast sequence alignment • 176 views
ADD COMMENTlink modified 7 months ago by i.sudbery5.9k • written 7 months ago by Neu10

Hi @Neu, its not clear what you mean by the word "dissolve". Do you mean parse? Or filter?

ADD REPLYlink written 7 months ago by i.sudbery5.9k
0
gravatar for i.sudbery
7 months ago by
i.sudbery5.9k
Sheffield, UK
i.sudbery5.9k wrote:

Depending on what lanuage you preffer you might like to check out the Biopython blast results parser (see introduction here). I guess bioperl, biojava probably have similar tools. R has something called rBLAST, but I've never used it.

ADD COMMENTlink written 7 months ago by i.sudbery5.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1942 users visited in the last hour