Question: Understanding 9th field of Bam file - insert size?
0
gravatar for a.rex
5 weeks ago by
a.rex180
a.rex180 wrote:

I have a pair of reads that look like this:

SRR8441376.13963941 69  g4_1    558410  0   *   =   558410  0   GTATAATCTAATTGTTCATGATGGAATTCATATTGTTCAATTGCGTTATTATAATTACTTAGTTGCTTAATTTG  AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEEEEE  YT:Z:UP
SRR8441376.13963941 153 g4_1    558410  0   74M =   558410  0   TATAATTACTTAGTTGCTTAATTTGATTTTTCGTCGTTGCATAACTGTGAGGATTTAATTCTGCCGTGTAGCGT  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA  AS:i:-15    XS:i:-20    XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:28C23G18T2 YT:Z:UP

The insert size looks likes its zero? When I use Picard Tools insert metrics will this be zero? Does this not account for the size of the read?

sequencing alignment • 115 views
ADD COMMENTlink modified 5 weeks ago by ATpoint15k • written 5 weeks ago by a.rex180

you're formatting is unreadable, there's ="" inserted everywhere in the second read. Other than that insert size is the distance between first and second read and not encoded in any field -> see specs

ADD REPLYlink written 5 weeks ago by Carambakaracho1.0k

Please use the formatting bar to highlight code and data examples for readablity.

123

ADD REPLYlink written 5 weeks ago by ATpoint15k
3
gravatar for Pierre Lindenbaum
5 weeks ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum119k wrote:

http://broadinstitute.github.io/picard/explain-flags.html flag 69: the read is UNMAPPED while the mate is mapped. Therefore, there is no 'fragment' size

ADD COMMENTlink written 5 weeks ago by Pierre Lindenbaum119k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1448 users visited in the last hour