Understanding 9th field of Bam file - insert size?
1
0
Entering edit mode
5.4 years ago
a.rex ▴ 350

I have a pair of reads that look like this:

SRR8441376.13963941 69  g4_1    558410  0   *   =   558410  0   GTATAATCTAATTGTTCATGATGGAATTCATATTGTTCAATTGCGTTATTATAATTACTTAGTTGCTTAATTTG  AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEE<EEEEEEEEEEEEEEEE  YT:Z:UP
SRR8441376.13963941 153 g4_1    558410  0   74M =   558410  0   TATAATTACTTAGTTGCTTAATTTGATTTTTCGTCGTTGCATAACTGTGAGGATTTAATTCTGCCGTGTAGCGT  EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA  AS:i:-15    XS:i:-20    XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:28C23G18T2 YT:Z:UP

The insert size looks likes its zero? When I use Picard Tools insert metrics will this be zero? Does this not account for the size of the read?

sequencing alignment • 981 views
ADD COMMENT
0
Entering edit mode

you're formatting is unreadable, there's ="" inserted everywhere in the second read. Other than that insert size is the distance between first and second read and not encoded in any field -> see specs

ADD REPLY
0
Entering edit mode

Please use the formatting bar to highlight code and data examples for readablity.

123

ADD REPLY
3
Entering edit mode
5.4 years ago

http://broadinstitute.github.io/picard/explain-flags.html flag 69: the read is UNMAPPED while the mate is mapped. Therefore, there is no 'fragment' size

ADD COMMENT

Login before adding your answer.

Traffic: 1650 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6