How to interpret a short TLEN with 75bp PE seq?
1
0
Entering edit mode
5.4 years ago
a.rex ▴ 350

I have a pair of mapped reads that look like this:

SRR8441376.12918543   99  g4_3    1773574 45  40S25M10S   =   1773574 25  CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTC AAAAAEEEAEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEAEEEEEEAE<EEA/EEEE//E/EEAEE/EEEAAAA MD:Z:19T5   PG:Z:MarkDuplicates NM:i:1  AS:i:20 XS:i:0
SRR8441376.12918543   147 g4_3    1773574 45  26S25M23S   =   1773574 -25 CGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTCCGCCTGGTAGTCC  EEE/EEEEEE<EE<EEEEEEEEEEEEAEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA  MD:Z:19T5   PG:Z:MarkDuplicates NM:i:1  AS:i:20 XS:i:0
  

The TLEN looks to be 25bp? I have trimmed the reads. I have done a blast of these reads to the genome and the read only aligns for 25bp. Does this mean that the rest of the read is adapter?

sequence alignment • 827 views
ADD COMMENT
0
Entering edit mode

25 bps is what your CIGAR tells you as well. more on CIGARs in the specs, reading is key ;) find adapters blasting against ncbi NR or use fastqc

ADD REPLY
2
Entering edit mode
5.4 years ago

bott reads are mapped at the very same place.

botth reads are soft clipped.

the 40th first bases CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCAC and the last 10 th bases GGTCTTGTTC of your first read are not mapped to the reference.

Does this mean that the rest of the read is adapter?

align those clipped parts to your collection of adapters..., check if if you find those sequences in the other reads....

ADD COMMENT

Login before adding your answer.

Traffic: 2427 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6