Question: How to interpret a short TLEN with 75bp PE seq?
0
gravatar for a.rex
9 months ago by
a.rex190
a.rex190 wrote:

I have a pair of mapped reads that look like this:

SRR8441376.12918543   99  g4_3    1773574 45  40S25M10S   =   1773574 25  CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTC AAAAAEEEAEEEEEEEEEE6EEEEEEEEEEEEEEEEEEEEAEEEEEEAE<EEA/EEEE//E/EEAEE/EEEAAAA MD:Z:19T5   PG:Z:MarkDuplicates NM:i:1  AS:i:20 XS:i:0
SRR8441376.12918543   147 g4_3    1773574 45  26S25M23S   =   1773574 -25 CGCTGAAGTCCGGCCCCAGTTCGCACATTTCGGTGACGAACTGCAACACCCGGTCTTGTTCCGCCTGGTAGTCC  EEE/EEEEEE<EE<EEEEEEEEEEEEAEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA  MD:Z:19T5   PG:Z:MarkDuplicates NM:i:1  AS:i:20 XS:i:0
  

The TLEN looks to be 25bp? I have trimmed the reads. I have done a blast of these reads to the genome and the read only aligns for 25bp. Does this mean that the rest of the read is adapter?

alignment sequence • 231 views
ADD COMMENTlink modified 9 months ago by Pierre Lindenbaum124k • written 9 months ago by a.rex190
3

how about your previous questions ? take some time to comment and validate the answers.

Insert size of ~20bp with ATAC-seq? ; Understanding 9th field of Bam file - insert size? ; How can I use featurecounts after generating a bam file using BWA? ; Using FeatureCounts for ChIP-seq normalised files? ; ....

ADD REPLYlink written 9 months ago by Pierre Lindenbaum124k

25 bps is what your CIGAR tells you as well. more on CIGARs in the specs, reading is key ;) find adapters blasting against ncbi NR or use fastqc

ADD REPLYlink written 9 months ago by Carambakaracho1.9k
2
gravatar for Pierre Lindenbaum
9 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum124k wrote:

bott reads are mapped at the very same place.

botth reads are soft clipped.

the 40th first bases CAGCGTGAGCGGTTCGCTGAAGTCCGGCCCCAGTTCGCAC and the last 10 th bases GGTCTTGTTC of your first read are not mapped to the reference.

Does this mean that the rest of the read is adapter?

align those clipped parts to your collection of adapters..., check if if you find those sequences in the other reads....

ADD COMMENTlink written 9 months ago by Pierre Lindenbaum124k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 923 users visited in the last hour