Question: Selecting the correct docking position in miRNAs
0
gravatar for chan.cordeiro
20 months ago by
chan.cordeiro0 wrote:

Asking on behalf of a colleague who is trying to dock a drug to miR-155..

Only positions 12 and 24 are different from murine miR. Should these two positions be targeted?

>mmu-mir-155
uuaaugcuaauugugauaggggu
>hsa-miR-155-5p
uuaaugcuaaucgugauagggguu
rna-seq mirna docking • 283 views
ADD COMMENTlink modified 20 months ago by h.mon31k • written 20 months ago by chan.cordeiro0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1010 users visited in the last hour