Question: Understanding trimmomatic adapter files and trimming
0
gravatar for Ml6237
6 months ago by
Ml62370
Ml62370 wrote:

Hello all,

I have paired end rna-seq reads and have tried to trim using trimmomatic. I am trying to better understand how it works. For the adapters file used for trimming, TruSeq3-PE.fa did not remove adapters from overrepresented sequences in FastQC but TruSeq3-PE-2.fa did which includes reverse complements of adapter sequences did. This file is shown below.

>PrefixPE/1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE/2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE1_rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>PE2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE2_rc
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

Just for a quick look at raw reads using grep, it was mainly PE2_rc detected in the forward read and in the reverse read, it was mainly PE1_rc that was detected. But not PrefixPE/1 in forward read and PrefixPE/2 in reverse read.

Question: is this normal for PE2_rc to be found in read 1 and PE1_rc to be found in read 2? (I guess I was expecting PrefixPE/1 to be found in read 1 and PrefixPE/2 in read 2)

Thanks.

rna-seq trimmomatic • 274 views
ADD COMMENTlink modified 4 months ago by Biostar ♦♦ 20 • written 6 months ago by Ml62370
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 888 users visited in the last hour