Entering edit mode
4.9 years ago
ognjen011
▴
250
The following paper has the following section on methylation in methodology: https://www.sciencedirect.com/science/article/abs/pii/S0143400415008991?via%3Dihub
DNA methylation analysis
Genomic DNA samples obtained from the normal and PE placentas were purified using DNAzol (Invitrogen). Purified DNA was treated with sodium bisulfite (Sigma, Phoenix, USA), and then it was analyzed by bisulfite-sequencing PCR (BSP) or methylation-specific PCR (MSP) as previously described [26]. The base sequence of LAMA4 was as follows: GAGGGAGAGAGAGGCTGGAACTCTCCCTTACTCTCGCACTT TCCCTTTATTTCCTAAGCTGC TGGTTGCGCAGCCACC TCGGGATAC TGCACACGGAGAGGA GGGAAAATAAGCGAGGCACCGCCGCACCACGCGGGAGACCTACGGAGACCCACAGCGC CCGAGCCCTGGAAGAGCACTACTGGATGTCAGCGGAGAAATGGCTTTGAGCTCAGCCTGG CGCTCGGTTCTGCC TCTGTGGCTCC TCTGGAGCGCTGCC T GC T CCCGCGCCGC GT CCGG G GACGACAACGCTTTTCCTTTTGACATTGAAGGGAGCTCAGCGGTTGGCAGGCAAGACCCG CCTGAGACGAGCGAACCCCGCGTGGCTCTGGGACGCCTGCCGCCTGCGGCCGAGGTACAG TGTCCCTGCCATTGCCACC. The methylation-specific primers are InF: 50- GAGGGA- GAGAGAGGTTGGAAT and InR: 50- AATAACAATAACAAAAACACTATACCTC. Amplified bisulfite PCR products were subcloned into a TA vector system (Promega) according to the manufacturer's instructions. DNA sequencing was performed on five indi- vidual clones (Sangong, China). The PCR products were confirmed by agarose gel electrophoresis and visualized using ethidium bromide staining.
I don't understand why all the steps are present, as they seem redundant in my limited knowledge. If a sequence is amplified by PCR, why are they subcloned before sequencing?
(If someone can access the paper, I am also unclear about the Fig. 10 - the subtext implies this is the result of the whole cohort, but the methods imply these are all clones from a single sample)