aligning with igblast
0
0
Entering edit mode
2.5 years ago
genya35 ▴ 40

Hello,

I'm having a difficult time aligning the following sequence of IGK gene to a reference using igblast. It works with other tools but I must use igblast since it's part of the pipeline. Could someone please suggest how to tweak the parameters to get it to align?

Thanks

>test_sequence
  AGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTGATGCTGCCGTAGCCAGCTTTCCTGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCC

reference:

>IGKDEL
GGTACCTGAAGAATTTTCAGGATCAACATTTGTAAGCATTATCAGCCCAGGATAATGCTTATTTACAGCA
GTTCAACTTTTCTCACCTGCAGTAGTTTACTTTGATGAAATCCTGCTTATTTTTCACAATTAAAATTGCG
TCCATGGCCCTTGTTACCCTTAAGAATTATATTTTGCTGACACAATCTCTTTATCTACATTTCACCTAAG
TAAGCTTTTTCTTTACATGATTTTAAGTCATTTTCCAAAACAGAAAAGCATAATTATACAACCTTCTATG
TGTATTGGAGGAAAAAAAGGGTCACACAAATAATAGTACACTCTCTCAGTTAAGGAGTAGGCAGGAGGAG
GGGGTTGAGAAAGACAAACCAGAAAGAATTACATGAAATTTTCCTTCCTCCTCACTGAGCCTCCCTTGAA
TTGTCCAATAATATCCCCCCAACACACACACATAGACACAGAGCAGACTGTGAGGGACACGCAGCCTGGG
TGGGACTCCAGGAGCCAGCTCTTACCCTAGAGTTTCTGCACGGGCAGCAGGTTGGCAGCGCACACTGTGG
GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTG
GAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGGACCTGTCTG
TAAACGTCCAGAGAAAAGCATGTGCCTGAAGGGTCTATGAAGGGGCTTGAGGCAAGTAGGGAGCCCAGCC
CAGCTAACATTTGCAGCCATGGGATGGCTTTGTGTACCTAGAAAAGCAAAGATGAGGACTAGGCGAGCAC
AGGCCCCAAACGTTCACGATACACATCTCACTGCAAAGAAATGTCCTCTGGCCACTTTATAATGCAGCTC
TAACTATAACTGGTGCTTTGCTGGTTTGTGGCCTGGGCTGGTCTCCCAGAGTCAGTGGCTTTGGGTGAGA
TGGCTCCAGGAGACAGCAGAAACTCTCATATATGAAGCCTTGCTTGCAGCGATTTGAGGCTTACTAGGGA
AAAGCCATGATGGGTTTTATAGAGCATTAACTGTGATACGCCATCTAGGGCTGAGAGCTC
alignment • 443 views
ADD COMMENT
0
Entering edit mode

What is a hard time? You failed to install and / or configure IgBLAST? Or is IgBLAST segfaulting or throwing any other kind of error message? Or you don't know how to use its command-line options? Or IgBLAST is running but its results are meaningless / strange?

Please explain how you are trying to run the tool, what do you mean by "hard time", and which are the error messages, if any.

ADD REPLY
0
Entering edit mode

i have no problem with running igblast, however, it's not returning this particular del as a match for J region. Thanks

ADD REPLY

Login before adding your answer.

Traffic: 1552 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6