Question: Plasmodium falciparum SNPS analysis
0
gravatar for kihugaharrison
9 days ago by
kihugaharrison0 wrote:

I have 29 plasmodium falciparum whole genome sequences that i need to analyse for SNPs. The problem is, each sample contains multiple sequences of upto 768,000 neucleotides....i need to convert this into a single sequence. How do i do this?

genome • 74 views
ADD COMMENTlink written 9 days ago by kihugaharrison0

Can you please try to explain better the data that you have? Show examples, if possible.

ADD REPLYlink modified 9 days ago • written 9 days ago by Kevin Blighe43k

Dear Kevin,

I have raw whole genome sequences 150 bases long that look like this....

family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/1
TCATGAAATACAACCATAAAATTGAGTTTTAGGTCCAAAATTCCTTACCTTAACGAAGTCTCTTGATTTCTCTCTTCAGAATCTCCCAAAAAGCTCCAAGGTCGAAGGCAACCATGGTGAAAAAACCCAAAATCGCGAAATGAAATAACA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/2
GATGCGGAAAGGCCTGGGCAGACCATATATGTTATTTCATTTCGCGATTTTGGGTTTTTTCACCATGGTTGCCTTCGACCTTGGAGCTTTTTGGGAGATTCTGAAGAGAGAAATCAAGAGACTTCGTTAAGGTAAGGAATTTTGGACCTA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023126.1:ST-E00493:300:HFKVJCCXY:6:2202:3599:38139/1
ATGAGCTAAAAGCAAGGTTATGGGTACGGTAAAGGCTGTTCCAGACCATAAGAAAGAAACAATTGTACACTAAACATACGGTAGAACCACCTTTTCTTACCATATTTGTAATTACTGTATGACATTACTTGAGAAATTGAGGATTTCATT
ADD REPLYlink modified 9 days ago by Kevin Blighe43k • written 9 days ago by kihugaharrison0
1

That looks like raw illumina data converted to fasta (with a changed header) and interleaved (R1/R2 following each other).

Are these in one file or you have 29 files? It would be useful to have Q-scores for alignments/SNP calling.

If possible you should acquire original fastq format data and start there.

ADD REPLYlink written 9 days ago by genomax68k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 560 users visited in the last hour