Question: Suspicious feature from 16S rRNA gene analysis using archaeal primers
0
gravatar for will.wcb
12 months ago by
will.wcb20
will.wcb20 wrote:

One of the top features in our 16S sequencing is very suspicious. It was not even classified to domain level using sklearn in QIIME2 on the Silva 132 database. When I blast the sequence there are no hits except with quite low scores, ~48, and high E-vales. It is the exact length of the other, assignable features.

Any ideas what kind of artifact this could be? Or how we can look more into it?

Here is the sequence TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA

Edit: replaced sequence

16s • 229 views
ADD COMMENTlink modified 12 months ago • written 12 months ago by will.wcb20

Sorry, I placed the wrong sequence, here is the correct one

TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA

ADD REPLYlink written 12 months ago by will.wcb20
1

Blasting that with megablast don't have any significant hit, using blastn it gives the short hits that you described, so I guess is just contamination.

ADD REPLYlink written 12 months ago by JC10k

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question.

ADD REPLYlink written 12 months ago by genomax85k
2
gravatar for JC
12 months ago by
JC10k
Mexico
JC10k wrote:

Blasting your sequence to NT, the best hit is a 16S from uncultured archaea (Score=641, Query cov=80%, E=6e-180, %identity=95.31%)

ADD COMMENTlink written 12 months ago by JC10k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1656 users visited in the last hour