Question: Suspicious feature from 16S rRNA gene analysis using archaeal primers
0
gravatar for will.wcb
7 weeks ago by
will.wcb20
will.wcb20 wrote:

One of the top features in our 16S sequencing is very suspicious. It was not even classified to domain level using sklearn in QIIME2 on the Silva 132 database. When I blast the sequence there are no hits except with quite low scores, ~48, and high E-vales. It is the exact length of the other, assignable features.

Any ideas what kind of artifact this could be? Or how we can look more into it?

Here is the sequence TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA

Edit: replaced sequence

16s • 101 views
ADD COMMENTlink modified 7 weeks ago • written 7 weeks ago by will.wcb20

Sorry, I placed the wrong sequence, here is the correct one

TAAAAGAGTTGCTGGCGAACGAAGGGCGTCCCGAAGCGACAGTAGATCCTGTTATCGAGGAAATATCGGCAACCGCCGTGGGCCTTACCTTCAAGATCGTAGAGGGTCCCCGGTTCAGAGTCGCCGACATAGAGTTTGAAGGCAACACGGTCTTCTCGAGTTCTCACCTCAGAAAGAACATGAAGCTTGTGAAGAAAGTGGGTCTCCTGACCACCTTCAGCTCGAAGGACATCTACCACAAAGAAAAATTCGAAGCTGATCTTGATCGCCTCCGCGTGCTGGTATACGCCGATCAAGGCTATTTGAAAGCGAGGTTTGGAGAACCGCGAGTCGAGGAAGTAGGCAAAATCGGCAACTGGCTGCCGATCATCGGACACAAGGGCGAGGGGCTGAAGATCGTTGTTCCCGTCGAGGAAGGCCGCCAGTACCGCGCCGCAGAGGTGAAGGTTGAAGACAACACGGAGTTTACGGCCGAGGAAATCAAGGCAATCATTGGTCTCA

ADD REPLYlink written 7 weeks ago by will.wcb20
1

Blasting that with megablast don't have any significant hit, using blastn it gives the short hits that you described, so I guess is just contamination.

ADD REPLYlink written 7 weeks ago by JC8.2k

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question.

ADD REPLYlink written 7 weeks ago by genomax70k
2
gravatar for JC
7 weeks ago by
JC8.2k
Mexico
JC8.2k wrote:

Blasting your sequence to NT, the best hit is a 16S from uncultured archaea (Score=641, Query cov=80%, E=6e-180, %identity=95.31%)

ADD COMMENTlink written 7 weeks ago by JC8.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1779 users visited in the last hour