Question: Randomly got the following error: CRITICAL: Error executing: kneaddata_bowtie2_discordant_pairs but all the files before look fine?
0
gravatar for O.rka
16 months ago by
O.rka230
O.rka230 wrote:

Does anyone know what this could be? I've never gotten this error before and I've used kneaddata a lot.

(base) -bash-4.1$ cat metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.log
07/15/2019 09:18:46 PM - kneaddata.knead_data - INFO: Running kneaddata v0.7.2
07/15/2019 09:18:46 PM - kneaddata.knead_data - INFO: Output files will be written to: /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing
07/15/2019 09:18:46 PM - kneaddata.knead_data - DEBUG: Running with the following arguments:
verbose = False
bmtagger_path = None
minscore = 50
bowtie2_path = /usr/local/bin/bowtie2
maxperiod = 500
no_discordant = False
serial = False
fastqc_start = False
bmtagger = False
cat_final_output = False
log_level = DEBUG
log = /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.log
max_memory = 500m
remove_intermediate_output = False
fastqc_path = None
output_dir = /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing
trf_path = None
remove_temp_output = True
reference_db = /usr/local/scratch/METAGENOMICS/jespinoz/db/genomes/human/GRCh38.p13/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index
input = /usr/local/scratch/METAGENOMICS/jespinoz/plastisphere/seq_raw/31-PE-N718S517-1_S12_R1_001.fastq.gz /usr/local/scratch/METAGENOMICS/jespinoz/plastisphere/seq_raw/31-PE-N718S517-1_S12_R2_001.fastq.gz
pi = 10
reorder = False
pm = 80
trimmomatic_path = /usr/local/bin/trimmomatic-0.35.jar
store_temp_output = False
mismatch = 7
threads = 16
delta = 7
bowtie2_options = --seed 0 --phred33
bypass_trim = False
processes = 1
trimmomatic_quality_scores = -phred33
fastqc_end = False
trf = False
trimmomatic_options = None
output_prefix = kneaddata
match = 2

07/15/2019 09:18:46 PM - kneaddata.utilities - INFO: Decompressing gzipped file ...
07/15/2019 09:18:47 PM - kneaddata.utilities - INFO: Decompressed file created: /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/decompressed_DAVjLS_31-PE-N718S517-1_S12_R1_001.fastq
07/15/2019 09:18:47 PM - kneaddata.utilities - INFO: Decompressing gzipped file ...
07/15/2019 09:18:47 PM - kneaddata.utilities - INFO: Decompressed file created: /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/decompressed_gIbHnD_31-PE-N718S517-1_S12_R2_001.fastq
07/15/2019 09:18:47 PM - kneaddata.utilities - INFO: Reformatting file sequence identifiers ...
07/15/2019 09:18:48 PM - kneaddata.utilities - INFO: Reformatting file sequence identifiers ...
07/15/2019 09:18:49 PM - kneaddata.utilities - INFO: READ COUNT: raw pair1 : Initial number of reads ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersAbBKXw_decompressed_gIbHnD_31-PE-N718S517-1_S12_R2_001 ): 56089
07/15/2019 09:18:49 PM - kneaddata.utilities - INFO: READ COUNT: raw pair2 : Initial number of reads ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersWHuU4h_decompressed_DAVjLS_31-PE-N718S517-1_S12_R1_001 ): 56089
07/15/2019 09:18:49 PM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersWHuU4h_decompressed_DAVjLS_31-PE-N718S517-1_S12_R1_001
07/15/2019 09:18:49 PM - kneaddata.utilities - DEBUG: Checking input file to Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersAbBKXw_decompressed_gIbHnD_31-PE-N718S517-1_S12_R2_001
07/15/2019 09:18:49 PM - kneaddata.utilities - INFO: Running Trimmomatic ...
07/15/2019 09:18:49 PM - kneaddata.utilities - INFO: Execute command: java -Xmx500m -jar /usr/local/bin/trimmomatic-0.35.jar PE -threads 16 -phred33 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersWHuU4h_decompressed_DAVjLS_31-PE-N718S517-1_S12_R1_001 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersAbBKXw_decompressed_gIbHnD_31-PE-N718S517-1_S12_R2_001 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq ILLUMINACLIP:/usr/local/devel/ANNOTATION/jespinoz/anaconda/envs/mage_env/lib/python2.7/site-packages/kneaddata/adapters/NexteraPE-PE.fa:2:30:10:8:TRUE SLIDINGWINDOW:4:20 MINLEN:150
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: TrimmomaticPE: Started with arguments:
 -threads 16 -phred33 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersWHuU4h_decompressed_DAVjLS_31-PE-N718S517-1_S12_R1_001 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/reformatted_identifiersAbBKXw_decompressed_gIbHnD_31-PE-N718S517-1_S12_R2_001 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq ILLUMINACLIP:/usr/local/devel/ANNOTATION/jespinoz/anaconda/envs/mage_env/lib/python2.7/site-packages/kneaddata/adapters/NexteraPE-PE.fa:2:30:10:8:TRUE SLIDINGWINDOW:4:20 MINLEN:150
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 56089 Both Surviving: 14369 (25.62%) Forward Only Surviving: 15061 (26.85%) Reverse Only Surviving: 421 (0.75%) Dropped: 26238 (46.78%)
TrimmomaticPE: Completed successfully

07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking output file from Trimmomatic : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: READ COUNT: trimmed pair1 : Total reads after trimming ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq ): 14369
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: READ COUNT: trimmed pair2 : Total reads after trimming ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq ): 14369
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan1 : Total reads after trimming ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq ): 15061
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: READ COUNT: trimmed orphan2 : Total reads after trimming ( /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq ): 421
07/15/2019 09:18:52 PM - kneaddata.run - INFO: Decontaminating ...
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - DEBUG: Checking input file to bowtie2 : /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: Running bowtie2 ...
07/15/2019 09:18:52 PM - kneaddata.utilities - INFO: Execute command: kneaddata_bowtie2_discordant_pairs --bowtie2 /usr/local/bin/bowtie2 --threads 16 -x /usr/local/scratch/METAGENOMICS/jespinoz/db/genomes/human/GRCh38.p13/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index --bowtie2-options "--seed 0 --phred33" -1 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq -2 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq --un-pair /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_paired_clean_%.fastq --al-pair /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_paired_contam_%.fastq -U /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq,/local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq --un-single /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_unmatched_%_clean.fastq --al-single /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_unmatched_%_contam.fastq -S /dev/null
07/15/2019 09:18:52 PM - kneaddata.utilities - CRITICAL: Error executing: kneaddata_bowtie2_discordant_pairs --bowtie2 /usr/local/bin/bowtie2 --threads 16 -x /usr/local/scratch/METAGENOMICS/jespinoz/db/genomes/human/GRCh38.p13/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index --bowtie2-options "--seed 0 --phred33" -1 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.1.fastq -2 /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.2.fastq --un-pair /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_paired_clean_%.fastq --al-pair /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_paired_contam_%.fastq -U /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.1.fastq,/local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata.trimmed.single.2.fastq --un-single /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_unmatched_%_clean.fastq --al-single /local/ifs3_scratch/METAGENOMICS/jespinoz/plastisphere/metagenome_output/31-PE-N718S517-1_S12/preprocessing/kneaddata_GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.bowtie_index_bowtie2_unmatched_%_contam.fastq -S /dev/null
assembly • 680 views
ADD COMMENTlink modified 16 months ago • written 16 months ago by O.rka230

2nd part:

07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Total memory = 252.185920715 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Available memory = 249.285884857 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Free memory = 234.216808319 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Percent memory used = 1.1 %
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: CPU percent = 0.0 %
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Total cores count = 56
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Total disk = 0.953025817871 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Used disk = 0.654418945312 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Percent disk used = 72.5 %
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process create time = 2019-07-15 21:18:52
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process user time = 0.05 seconds
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process system time = 0.03 seconds
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process CPU percent = 0.0 %
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process memory RSS = 0.00945281982422 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process memory VMS = 0.126251220703 GB
07/15/2019 09:18:53 PM - kneaddata.utilities - INFO: Process memory percent = 0.00376196739005 %
ADD REPLYlink written 16 months ago by O.rka230
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1109 users visited in the last hour