Question: MIseq-Paired End Data Barcodes
0
gravatar for guptavipin142
6 months ago by
United States
guptavipin1420 wrote:

Hello Folks,

My vendor gave me file for paired end data like this

@M04631:335:000000000-CDFRH:1:2106:7814:1782 1:N:0:ATGCGCAG+AAGGCTAT
CCTACGGGGGGCAGCAGTCGGGAATTTTGGTCAATGGGCGAAAGCCTGACCCAGCCACGCCGCGTGAAGGATGAATTATTTCGGTATTTTAACTTCGTATTATTGGGAAGAATAAATGACTGTACCTTTTATAAGGTCCGTCTAACTACGTTCCAGCAGCCGCGGTAATACGTAGGGACCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCTAACAAGTCACTTGTGAAATCTCCGGGCTTAACTCGGAATGGCCAAGTGAAACTGTCAGGCTAGAGTGCAGAAGGG
+
C@CCCGDB5=@1+,894C8,477+:=EE<+-:--C<,=<C::+=<BF,,,?=88E+,,+3=:>=C7+8,@8@,,,,<,38@9,*C7D93,8F,<@,*,,,33,<<<,,?>3::A?,8,,<,8@,,,,@F:;F,,,88,8<*=F*82>,2=<,<,,,<,<FGC*:8:/::<:FCFCGCF5:88/;CGEEEFGDGGGGGFFFFEFFEG8E>?7CECEEEE>8@?E88;*88<+;<:9:9:CF@>0?F0<9+)1?*/;8<<:+;9?<*0C*+92;:F@FGGCGFF<@65F*/3CE*-:<9/0>D
@M04631:335:000000000-CDFRH:1:2106:16910:1792 1:N:0:ATGCGCAG+AAGGCTAT
CCTACGGGAGGCAGCAGTAAGGAATATTGCACAATGTGCGCAAGCCTGATCCAGCCATACCGCGTGCAGGAAGAATGTCCTTTTTTTTTTAAACTCCTTTTATATGGGAAGAATGGCTTCTTCTTTTCGCATTTTGACTTTACCATACTACTAAGCACCGGCTAACTCCGTGCCATCAGCCGCGGTAATACGTAGCGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGCTAAGATAGGTGTGAAATCACAGAGCTTAACCTGGGAACGGCGGTTGTGATTAG
+

I am processing the data with qiime2 but not sure what value to be used for barcodes in metadata for each forward and reverse file. Any help will be useful

sequencing next-gen • 177 views
ADD COMMENTlink modified 6 months ago by genomax76k • written 6 months ago by guptavipin1420

Index sequences for R1 and R2 are present in the fastq header.

e.g. ATGCGCAG+AAGGCTAT represent R1_index+R2_index

ADD REPLYlink modified 6 months ago • written 6 months ago by genomax76k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 795 users visited in the last hour