Question: Mapping of novel peptide
0
gravatar for jahanshanzida
5 weeks ago by
jahanshanzida0 wrote:

Dear All,

I have got a couple of novel peptides by using PGA of R Bioconductor package. Now I want to map these novel peptides into genomic context. By using which bioinformatics tool I can map my novel peptides into New TIS, novel exon, a novel gene, novel splicing, UTR translation.

Thank you.

genome • 97 views
ADD COMMENTlink modified 5 weeks ago • written 5 weeks ago by jahanshanzida0

Is this a follow-up question on your previous post: Novel peptide identification ?

Do you actually have amino acid sequence now that you want to map to a genome reference?

ADD REPLYlink modified 5 weeks ago • written 5 weeks ago by genomax70k

Yes, this is a follow-up question.I have got two peptide by PGA bioconductor in R.These are :

VFLLPLCKSS PPLLDQDQIV LLRGWFLSTW NLKCPTSNHS LEFNGTLLCP
    LVEAFSLWKP RPLSLQN

chr1:87627704-87627922_+::::LINC01140|-|F3|1

I have then collected nucleotide sequence from USCS genome browser.

gggattccctactatctggatagctagtcatgactagagaagattctgcatggagacaatatatcatttatttggcttttatttttactgaattcagtgctcatggaaagtggcacattgacaacgctgcttcctagcatgacatcacataaataagtttgaagatactgcttaataagaaccctttaaagataagagaaatggtagaaagaat

Now I want to map it like novel exon,novel gene,novel splicing so that I can understand the position of these novel peptide.Is there any tools for that.

Also,Do you know any other method so that I can make sure that these peptides are novel.

Thank you.

Shanzida.

ADD REPLYlink modified 5 weeks ago by RamRS23k • written 5 weeks ago by jahanshanzida0

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time for the sequence. I am not sure what the alignment/amino acid sequence is supposed to look like so you can fix that.
code_formatting

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question. Thank you!

ADD REPLYlink written 5 weeks ago by genomax70k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1662 users visited in the last hour