Question: Trim fastq after and before motif occurance
gravatar for christina.galonska
11 months ago by
christina.galonska10 wrote:

Hi everyone,

Is there any easy way to trim a fasta/fastq before and after a certain motif occurance?

As example, this would be my sequence ATGAAACCTTTGGGGCCCCAGTCAGCTC

My motif of interest would be: GGGGCCCC

I want to trim let's say 5bp 5' and 3bp 3' of the motif occurance which would give you: CCTTTGGGGCCCCAGT

I searched around a bit but could not find any fitting tool. Any ideas/suggestions?

sequencing next-gen • 188 views
ADD COMMENTlink modified 11 months ago • written 11 months ago by christina.galonska10

You can probably adapt this solution in awk: Split a sequence in a fastq file

ADD REPLYlink written 11 months ago by ATpoint36k

Because of the unique requirement here you are likely going to need to write something yourself. Trimming programs are generally setup to trim/discard sequences (to left or right) once a particular k-mer motif is found in the sequence.

Using from BBMap suite you can filter out reads that contain the motif of interest by doing:

$ bbmap/ literal=NNNNNGGGGCCCCNNNNN k=18 copyundefined in=tt.fq outm=stdout.fq minlen=5

You can then work on that reduced dataset.

ADD REPLYlink modified 11 months ago • written 11 months ago by genomax87k
gravatar for christina.galonska
11 months ago by
christina.galonska10 wrote:

Just tested seqkit amplicon which actually did exactly that (option is only available in the pre-release of version v0.11.0 so far:

Corresponding command would be:

seqkit amplicon input.fastq -F GGGGCCCC -r -5:3 -f -o output.fastq

ADD COMMENTlink written 11 months ago by christina.galonska10
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 957 users visited in the last hour