Entering edit mode
4.6 years ago
rbronste
▴
420
Running into an error with Bowtie 2 paired end alignment as follows:
bowtie2 -p 12 --local --very-sensitive-local --no-unal --no-mixed --no-discordant --dovetail --phred33 --minins 10 --maxins 700 -x /genomes/bowtie2_mm10_index -1 IgG_EB_2_S10_R1_001_adapqual.fastq -2 IgG_EB_2_S10_R2_001_adapqual.fastq -S IgG_male_2.sam
Error: Read NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT has more quality values than read characters.
terminate called after throwing an instance of 'int' (ERR): bowtie2-align died with signal 6 (ABRT) (core dumped)
When I do the following to look at the read in the paired fastqs I get this:
grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R1_001_adapqual.fastq
@NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT
AAGCCCAGXC:2:1GGAGCCACCACTGTTGACGTCTG:1GGAGCGTGAGCCTTCAGGACTTCTTCCGTGTCCCCCA
+
6A6AAAA/EAEA///AE6/A/EAEAE//AEE/AEEE/AE/E/EEEAEE/A/EEEEEEEE<EEEEAEEEEEEAEEAE
grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R2_001_adapqual.fastq
@NB551387:262:H3FMVBGXC:2:13312:12350:6675 2:N:0:TAGCTT
TGTAGGTTTGGGGGACACGGAAGAAGTCCTGAAGGCTCACGCTCCAGCAGACATCCACAGAGGTGGCTCCAGCT
+
/6AA66///A///EEEEA//EEAEEE/A<//EEAEE/AEE/EAE//A/E/E/AE<EEEEA//E/6<EEEEEEEA
Wondering what may be happening? Thanks.
There appears to be a
:2:
in the read sequence of the first read. Is that really there or is it a cut and paste error?If the sequence on the first read contains XC:2:1 smells like your file is corrupted, hopefully, you have a back-up file with their checksums to validate integrity.
These parsing errors are in my experience a signal of low memory. How much RAM do you have available?