Question: Bowtie2 Error: *.* has more quality values than read characters
0
gravatar for rbronste
3 months ago by
rbronste300
rbronste300 wrote:

Running into an error with Bowtie 2 paired end alignment as follows:

bowtie2 -p 12 --local --very-sensitive-local --no-unal --no-mixed --no-discordant --dovetail --phred33 --minins 10 --maxins 700 -x /genomes/bowtie2_mm10_index -1  IgG_EB_2_S10_R1_001_adapqual.fastq -2  IgG_EB_2_S10_R2_001_adapqual.fastq -S IgG_male_2.sam

Error: Read NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT has more quality values than read characters.

terminate called after throwing an instance of 'int' (ERR):    bowtie2-align died with signal 6 (ABRT) (core dumped)

When I do the following to look at the read in the paired fastqs I get this:

grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R1_001_adapqual.fastq

@NB551387:262:H3FMVBGXC:2:13312:12350:6675 1:N:0:TAGCTT

AAGCCCAGXC:2:1GGAGCCACCACTGTTGACGTCTG:1GGAGCGTGAGCCTTCAGGACTTCTTCCGTGTCCCCCA

+

6A6AAAA/EAEA///AE6/A/EAEAE//AEE/AEEE/AE/E/EEEAEE/A/EEEEEEEE<EEEEAEEEEEEAEEAE

grep -A 3 "NB551387:262:H3FMVBGXC:2:13312:12350:6675" IgG_EB_2_S10_R2_001_adapqual.fastq

@NB551387:262:H3FMVBGXC:2:13312:12350:6675 2:N:0:TAGCTT

TGTAGGTTTGGGGGACACGGAAGAAGTCCTGAAGGCTCACGCTCCAGCAGACATCCACAGAGGTGGCTCCAGCT

+

/6AA66///A///EEEEA//EEAEEE/A<//EEAEE/AEE/EAE//A/E/E/AE<EEEEA//E/6<EEEEEEEA

Wondering what may be happening? Thanks.

fastq bowtie2 software error • 196 views
ADD COMMENTlink modified 7 weeks ago by Biostar ♦♦ 20 • written 3 months ago by rbronste300
1

There appears to be a :2: in the read sequence of the first read. Is that really there or is it a cut and paste error?

ADD REPLYlink written 3 months ago by i.sudbery6.3k
1

If the sequence on the first read contains XC:2:1 smells like your file is corrupted, hopefully, you have a back-up file with their checksums to validate integrity.

ADD REPLYlink written 3 months ago by JC9.1k

These parsing errors are in my experience a signal of low memory. How much RAM do you have available?

ADD REPLYlink written 3 months ago by ATpoint26k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1803 users visited in the last hour