How to define output for ALT tag in vcf file
1
0
Entering edit mode
2.2 years ago
kmkdesilva ▴ 90

Hi everyone,

I am looking at a VCF file and at one position, under ALT I saw the following nucleotides

 T,GATCACGTGCCTGATCATGCACTT
  1. Can someone please tell what the second ALT allele (GATCACGTGCCTGATCATGCACTT) is?

In another position I see REF and ALT as following

GTGATCACGTGACTGATCATGCAC        CTGATCACGTGACTGATCATGCAC,G
  1. Please tell me how to explain this as well
SNP next-gen sequencing • 474 views
ADD COMMENT
1
Entering edit mode
2.2 years ago
ATpoint 55k

It is an insertion. Additional nucleotides have been filled in. Does this answer your question, not sure I got it correctly?

ADD COMMENT
1
Entering edit mode

I think OP asks about the comma, which indicates that at this position there are two alternative alleles. The samples with e.g. 0/1 genotype are heterozygous for the first alternative allele, and 2/2 would mean homozygous for the second alternative allele.

ADD REPLY
0
Entering edit mode

Yes ATpoint that is what I wanted to know. Thank you. In the second position one of the ALT alleles is just G. Does this indicate a deletion at this position in some of the samples?

ADD REPLY
1
Entering edit mode

Yes, the first case is an insertion, one allele is "T", the other is "GATCACGTGCCTGATCATGCACTT"

The second case is a deletion, your reference is "GTGATCACGTGACTGATCATGCAC", then you have one allele "CTGATCACGTGACTGATCATGCAC" (note the single substitution in the first base G->C) and a second allele as "G------------" as a deletion

ADD REPLY
1
Entering edit mode

Now I understand it. Thank you everyone.

ADD REPLY

Login before adding your answer.

Traffic: 1583 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6