Question: Finding Common Motifs In Sequences
11
gravatar for Fabio
9.9 years ago by
Fabio110
Fabio110 wrote:

I have a few hundred yeast sequences (20-80bp long) and I want to find common motifs (conserved bases at certain indices) in them. I am using a Mac

motif • 16k views
ADD COMMENTlink modified 5.7 years ago by sanchezcavani210 • written 9.9 years ago by Fabio110
8
gravatar for Stew
9.3 years ago by
Stew1.4k
Cambridge
Stew1.4k wrote:

I would recommend MEME as others, however Weeder is also very easy to install and run on a Mac. It is word based and runs a lot faster than Meme, with a far fewer options.

If you would like something to run specifically on your Mac you could try iMotifs, which incorporates the NestedMICA algorithm for discovering over-represented motifs.

For a small set of sequences, such as yours, you could also use Meme, Weeder or others online without installing them locally. Finally, the Regulatory Sequence Analysis Tools (RSAT) ( http://rsat.ulb.ac.be/rsat/ or http://rsat.ccb.sickkids.ca/) are a great place to start for pattern matching and discovery.

In case it is of any use I have put up a short presentation about DNA motif finding from a course I gave earlier this year. You can find it here.

ADD COMMENTlink written 9.3 years ago by Stew1.4k
6
gravatar for Tom Koerber
9.9 years ago by
Tom Koerber60
Tom Koerber60 wrote:

You can also use MEME: http://meme.sdsc.edu/.

ADD COMMENTlink written 9.9 years ago by Tom Koerber60
6
gravatar for Marcos De Carvalho
9.5 years ago by
Porto Alegre, RS, Brasil
Marcos De Carvalho310 wrote:

Some time ago I used SOMBRERO (http://bioinf.nuigalway.ie/sombrero/download.html) with a good degree of success on finding motifs in a very diverse set of sequences. They have a Mac version for download as well as parallel versions for Irix and Linux.

ADD COMMENTlink written 9.5 years ago by Marcos De Carvalho310
5
gravatar for Michael Dondrup
9.5 years ago by
Bergen, Norway
Michael Dondrup46k wrote:

The first step when looking for conservation of single bases or motives is often a multiple sequence alignment that will align the sequences in a way such that conserved regions are best visible. This can be a first step before using explicit motif finders like MEME. A good way of visualizing multiple alignments is the sequence-logo that will give a graphical representation of base conservation.

Here is the wikipedia list of mult.-sequence alignment tools.

I recommend to start with the EBI web-server of ClustalW though, if that is not enough you can also try MAFFT or T-Coffee.

Weblogo can generate sequence-logo graphics from the output and also from fasta input directly.

Advantage of these tools is that you don't need to install them, so good for a first attempt irrespective of using a Mac.

ADD COMMENTlink written 9.5 years ago by Michael Dondrup46k
4
gravatar for Giovanni M Dall'Olio
9.6 years ago by
London, UK
Giovanni M Dall'Olio26k wrote:

Meme has been the first program to be published for doing that. As an alternative you can find one of the EMBOSS tools; if you are scared by a terminal and want to do it from a web-based interface, you can use the EMBOSS tools from galaxy

ADD COMMENTlink written 9.6 years ago by Giovanni M Dall'Olio26k
3
gravatar for Darked89
9.5 years ago by
Darked894.2k
Barcelona, Spain
Darked894.2k wrote:

You may check out these pages:

Bioinfotutorial#Promoterprediction

Wikiomics:Sequence_motifs

These are ca 2 years old (links may not work etc.) but as a starting point should be OK. Also in unlikely case you did not found it yet: in yeast there has been an extensive motif search study done by Kellis with insane number of citations:

Nature. 2003 May 15;423(6937):241-54.

Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES.

Sequencing and comparison of yeast species to identify genes and regulatory elements.

ADD COMMENTlink written 9.5 years ago by Darked894.2k
2
gravatar for Zhenhai Zhang
9.9 years ago by
Zhenhai Zhang170
502 Wartik Lab, Penn State Univ
Zhenhai Zhang170 wrote:

try this out?

http://fraenkel.mit.edu/webmotifs/form.html

ADD COMMENTlink written 9.9 years ago by Zhenhai Zhang170
2
gravatar for Suk211
9.9 years ago by
Suk2111.0k
state college
Suk2111.0k wrote:
ACGGGCCCGACGATGCGTCGTA

ACGTACGTCGAACCGTCGTCGT

ACGTGCGTCGAAACGTCAGTCG

ACGGGTTCGATCGTCGTCGTCG

may be in Python I will break down the first sequence of required motif length into a sliding window and will search for those list of motifs in the rest of sequences using regular expression in python using re.search() method.

ADD COMMENTlink modified 9.9 years ago by Istvan Albert ♦♦ 81k • written 9.9 years ago by Suk2111.0k
2

post the python code as well (put it into pre tags then it will be shown nicely formatted, see help on the right)

ADD REPLYlink written 9.9 years ago by Istvan Albert ♦♦ 81k
0
gravatar for sanchezcavani
5.7 years ago by
sanchezcavani210
Canada
sanchezcavani210 wrote:

I would recommend to use MEME. enter link description here

ADD COMMENTlink written 5.7 years ago by sanchezcavani210
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 617 users visited in the last hour