Question: how to use Ka/Ks calculator
0
gravatar for drragill
12 months ago by
drragill10
drragill10 wrote:

Hi, I want to calculate the divergence time of genes. Can somebody guide me on how to use the KaKs calculator software? Many thanks!

rna-seq alignment gene • 315 views
ADD COMMENTlink modified 11 months ago by Biostar ♦♦ 20 • written 12 months ago by drragill10
2

Please read the tool documentation, follow it accordingly, and then, if you encounter problems, post a question here. In the question, be as detailed as possible, for example, including a link to the tools page, and try to include sample data to reproduce the error.

ADD REPLYlink written 12 months ago by h.mon31k
1

Are you referring to the Ka/Ks calculator found here?

https://kakscalculator.herokuapp.com/

ADD REPLYlink written 12 months ago by Dave Carlson390

Dear h.mon and Dave Carlson,

Many thanks for your kind reply. But I encounter a problem as...Original Sequence has unconventional nucleotides. My input sequence (both) was in fasta format as below...

ATGAAAGGCACGTTATCACCCGCTCTAGGGAACCTCGGATCTCTCCAGGTTTTGTTCATT TCTGGAACCAAGTTCATTGCCGGCTCGATTCCCAACAGCTTCTCTAAGCTAACTAGTCTT ACTCAGCTCGTCCTCGATGATAACTCTCTCCAAGGCAACGTTCCTTCTTGTTTAGGCCAT CTTCCGTTCTTGGAGATTCTTTCATTGGCTGGAAACCGTTTCTCAGGTGTTGTCCCAGCG AGTTTGGGGAGCTTGAGAAGCCTCTCTGTGATGATGTTGGCTCGAAACTCTCTCTCTGGT CCAATCCCAGTGACGTTCAAGAACCTTGTCAAGCTTCAGACTCTTGACCTCAGCTTCAAT ATGTTATCTGGACCGATACCAGACTTCATAGGCCAGTTTCGGAATCTAACAACTCTTGAT CTCTCCAGCAACAGATTCTCCGGGGGACTACCGGTTTCTGTTTACAACTTGGGGAAGCTT

Could you please guide me on which format I should input..in detail. Many thanks!

Sincerely

ADD REPLYlink written 12 months ago by drragill10
1

This (these?) sequence is not in fasta format, and I don't see any unconventional characters in it.

ADD REPLYlink written 12 months ago by h.mon31k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2080 users visited in the last hour