Question: CPAT error while analysis
1
gravatar for rajpal22288
12 months ago by
rajpal2228850
Germany
rajpal2228850 wrote:

I am getting this error on running CPAT

cpat.py -g merged.fa -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.log

Traceback (most recent call last): File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 241, in <module> main() File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 229, in main print >>sys.stderr, "Input gene file is in FASTA format" TypeError: unsupported operand type(s) for >>: 'builtin_function_or_method' and '_io.TextIOWrapper'. Did you mean "print(<message>, file=<output_stream>)"?

No matter what format the input file is BED or FASTA, the error is persistent? Anyone else facing this error?

rna-seq software error gene • 271 views
ADD COMMENTlink modified 12 months ago by kristoffer.vittingseerup3.4k • written 12 months ago by rajpal2228850

To determine if it is the software or the file that is the problem would you try running (part of) the fasta file via their webserver?

ADD REPLYlink written 12 months ago by kristoffer.vittingseerup3.4k

Nope! The web server shows error while uploading. Tried uploading BED and FASTA format. The website is sending requests, but I guess the server is not responding.

ADD REPLYlink modified 12 months ago • written 12 months ago by rajpal2228850
0
gravatar for kristoffer.vittingseerup
12 months ago by
European Union
kristoffer.vittingseerup3.4k wrote:

I just tried the webserver with a fasta file and it worked fine so the problem is most likely your fasta file. From the error message I would look for cases where there are double ">" in the title of a sequence (e.g. ">>").

ADD COMMENTlink written 12 months ago by kristoffer.vittingseerup3.4k

Can you post the fasta file here? I downloaded a small fasta file from ucsc and tried, but it still doesn't work!! :(

ADD REPLYlink written 12 months ago by rajpal2228850

It's just a standard fasta file with the nucleotide sequence. If you want more help you would need to post (parts of) your file.

ADD REPLYlink written 12 months ago by kristoffer.vittingseerup3.4k

Hello, I got the same error can you resolve it Sample fasta

MSTRG.1687.1 GGCTTATTCTTTACTTTTTCCCACTTTTCCAGGCTCAGCGGGGAGCTGTTGGATGAGAAAGAGCCTGAAGTCTTGCAGGAGTCACTGGATAGATGCTATTCAACTCCTTCAGGTTGTCTTGAACTGA CTGACTCATGCCAGCCCTACAGAAGTGCCTTTTACATATTGGAGCAACAGCGTGTTGGCTTGGCTGTTGACATGGATG

ADD REPLYlink modified 7 months ago • written 7 months ago by mathavanbioinfo50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1575 users visited in the last hour