CPAT error while analysis
1
1
Entering edit mode
2.2 years ago
Hyper_Odin ▴ 230

I am getting this error on running CPAT

cpat.py -g merged.fa -d Human_logitModel.RData -x Human_Hexamer.tsv -o out.log

Traceback (most recent call last): File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 241, in <module> main() File "/u/rajeshpal93/scratch/miniconda2/envs/miRNA/bin/cpat.py", line 229, in main print >>sys.stderr, "Input gene file is in FASTA format" TypeError: unsupported operand type(s) for >>: 'builtin_function_or_method' and '_io.TextIOWrapper'. Did you mean "print(<message>, file=<output_stream>)"?

No matter what format the input file is BED or FASTA, the error is persistent? Anyone else facing this error?

RNA-Seq gene software error • 604 views
ADD COMMENT
0
Entering edit mode

To determine if it is the software or the file that is the problem would you try running (part of) the fasta file via their webserver?

ADD REPLY
0
Entering edit mode

Nope! The web server shows error while uploading. Tried uploading BED and FASTA format. The website is sending requests, but I guess the server is not responding.

ADD REPLY
0
Entering edit mode
2.2 years ago

I just tried the webserver with a fasta file and it worked fine so the problem is most likely your fasta file. From the error message I would look for cases where there are double ">" in the title of a sequence (e.g. ">>").

ADD COMMENT
0
Entering edit mode

Can you post the fasta file here? I downloaded a small fasta file from ucsc and tried, but it still doesn't work!! :(

ADD REPLY
0
Entering edit mode

It's just a standard fasta file with the nucleotide sequence. If you want more help you would need to post (parts of) your file.

ADD REPLY
0
Entering edit mode

Hello, I got the same error can you resolve it Sample fasta

MSTRG.1687.1 GGCTTATTCTTTACTTTTTCCCACTTTTCCAGGCTCAGCGGGGAGCTGTTGGATGAGAAAGAGCCTGAAGTCTTGCAGGAGTCACTGGATAGATGCTATTCAACTCCTTCAGGTTGTCTTGAACTGA CTGACTCATGCCAGCCCTACAGAAGTGCCTTTTACATATTGGAGCAACAGCGTGTTGGCTTGGCTGTTGACATGGATG

ADD REPLY

Login before adding your answer.

Traffic: 1745 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6