Question: error in trinity
0
gravatar for fatimarasool135
11 days ago by
fatimarasool13540 wrote:

hi , I am doing denovo assembly by using trinity. data is not from SRA . .but got these error .how can i resolve it ?

> 
> Error, not recognizing read name formatting: [NS500786:42:HA1AGGAAGACCACGAATTGCCTTGTGAAEEAEEEGXX:2:1210G:7930EAE/EEEEEAE/EAEEEEEE/AA<A/E/AE/EE/EEECGCAGATG13379EAAEEEEAAGAAAAA]

>If your data come from SRA, be sure to dump the fastq file like so:

  SRA_TOOLKIT/fastq-dump --defline-seq '@$sn[_$rn]/$ri' --split-files file.sra
rna-seq alignment assembly • 80 views
ADD COMMENTlink modified 9 days ago • written 11 days ago by fatimarasool13540

fatimarasool135 please share the complete command that you executed

ADD REPLYlink written 11 days ago by lakhujanivijay4.5k

Hi, I have run this command

Trinity --seqType fq --left /home/bioinfo/fatima/G2_forward_paired.fq --right /home/bioinfo/fatima/G2_reverse_paired.fq --max_memory 102G --output G2_trinity

ADD REPLYlink written 11 days ago by fatimarasool13540

the fastq file look like that

head G2_forward_paired.fq

@NS500786:42:HW75GBGXX:1:21307:2729:10394 1:N:0:TCCGGAGA+AGGATAGG
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEE66E6666
@NS500786:42:HW75GBGXX:4:11411:6035:6026 1:N:0:GCCGGAGA+AGGATAGG
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+
AEE6EAEEEEEEEEEEEEEEA6E6E6EEEA6666666666666666666/6
@NS500786:42:HW75GBGXX:3:12405:6583:13106 1:N:0:TCCGGAGA+AGGATAGG
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

G2_reverse_paired.fq

@NS500786:42:HW75GBGXX:1:21307:2729:10394 2:N:0:TCCGGAGA+AGGATAGG
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
+
AAAAAEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEA
@NS500786:42:HW75GBGXX:4:11411:6035:6026 2:N:0:GCCGGAGA+AGGATAGG
ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
+
6AAAA//AAA/AA///<A<A/A<AA<EEA//A</<<66/<//A6/<</6A66<<66/</66//6
@NS500786:42:HW75GBGXX:3:12405:6583:13106 2:N:0:TCCGGAGA+AGGATAGG
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
ADD REPLYlink modified 11 days ago by lakhujanivijay4.5k • written 11 days ago by fatimarasool13540

Could you at least spell the name of the tool you are using correctly? Please put some more effort into your questions.

ADD REPLYlink written 11 days ago by WouterDeCoster42k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1482 users visited in the last hour