Could not locate bowtie index (miRDeep2 analysis)
Entering edit mode
3.2 years ago


I have no idea what I've done wrong. I'm trying to run miRDeep2 on some miRNA seq runs. I have linked the bowtie (1) index files to the current directory, and (attempted) to save a path to the originals anyway, I kep getting an error message saying it can't find them.

Below is the script showing what I have in the working directory, the line I tried to execute and everything I got in response.

I then show my path, and that the path I think I used gets me to the files... Any help would be greatly appreciated. Apologies, I'm very new to this so have thrown everything I can think of at it (hence the directory is a pigstye).

  -bash-4.2$ ls

            -bash-4.2$ Test_1.fq -e  -j -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  -l 18 -m -h -p genome  -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -o 4 -v

            parsing fastq to fasta format
            discarding sequences with non-canonical letters
            clipping 3' adapters
            discarding short reads
            collapsing reads
            mapping reads to genome index
            Could not locate a Bowtie index corresponding to basename "genome"
            Please make sure you used bowtie version 1 to build the index.
            Usual index files have suffix .ebwt

            -bash-4.2$ echo $PATH
            -bash-4.2$ #checking the path to the index...
            -bash-4.2$ cd /rds/general/user/lah17/home/Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/
            -bash-4.2$ ls
            genome.1.ebwt  genome.2.ebwt  genome.3.ebwt  genome.4.ebwt  genome.fa  genome.rev.1.ebwt  genome.rev.2.ebwt
RNA-Seq miRNA miRDeep2 Bowtie index • 1.2k views
Entering edit mode


-p genome.

Edit* Checked previous times I have used and nope, that's not it. Maybe provide the path like:

-p ./genome
Entering edit mode

Hi, Ty for the suggestion!

I tried

  -p genome. 

    -bash-4.2$ Test_1.fq -e  -j -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  -l 18 -m -h -p genome. -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -o 4 -v

    parsing fastq to fasta format
    discarding sequences with non-canonical letters
    clipping 3' adapters
    discarding short reads
    collapsing reads
    mapping reads to genome index
    Could not locate a Bowtie index corresponding to basename genome.
    Please make sure you used bowtie version 1 to build the index.
    Usual index files have suffix .ebwt

Then, out of mild desperation...

  -p "genome.*"

    -bash-4.2$ Test_1.fq -e  -j -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  -l 18 -m -h -p “genome.*” -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -o 4 -v

    parsing fastq to fasta format
    discarding sequences with non-canonical letters
    clipping 3' adapters
    discarding short reads
    collapsing reads
    mapping reads to genome index
    Could not locate a Bowtie index corresponding to basename "genome.*"
    Please make sure you used bowtie version 1 to build the index.
    Usual index files have suffix .ebwt

Anything else I might try?

Going back to look at PATH..? To see if that might be the issue.

Entering edit mode

Give it a shot with the full path to the index files, or the relative path (try make a folder for em).

mkdir index
mv *ebwt* index/
cd ../ Test_1.fq -e  -j -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC  -l 18 -m -h -p index/genome -s reads_collapsed.fa -t reads_collapsed_vs_genome.arf -o 4 -v

You forgot to try -p ./genome which would be another take on the relative path. If this doesn't work then I'm not sure what to do, except to do the trimming manually (which I have had success with)..

Entering edit mode


Thank you for the suggestions. Still hasn't worked. Frustratingly, I have copies that have been trimmed already, I was just trying to do an all in one alignment. Is this what you use for alignment? Back to the drawing board.



Entering edit mode

Did you make the bowtie v.1 indexes yourself or downloaded them from somewhere? Are they known to work?

Entering edit mode

Have figured it out. I missed a full stop when I linked the bowtie sequences. It was looking through the root directory rather than from the current directory I was in.

I learned that black highlight of anything that you ls is not a good thing!

Entering edit mode

Great! Put up the fixed code, just as a future reference for anyone else coming across the same issue

Entering edit mode
3.2 years ago

Solution: (I have been using 'Big Data Analysis for Bioinformatics and Biomedical Discoveries, by Shui Qing Ye) There are some errors in the book, but this one was all me,

When linking the the genome and the bowtie index into the current working directory:

  ln -s ./Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.1.ebwt
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.2.ebwt
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.3.ebwt
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.4.ebwt
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.rev.1.ebwt
    ln -s ./Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome.rev.2.ebwt

it may need to be run line by line....

This was based on the files being found from the current directory. then running: Sample_name.fq -v -q -n -o 4 -u -e -h -m -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -p genome -s reads_ collapsed.fa -t reads_collapsed_vs_genome.arf

Login before adding your answer.

Traffic: 999 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6