Question: Help Troubleshooting FASTQC
0
gravatar for mac03pat
13 months ago by
mac03pat30
mac03pat30 wrote:

My FASTQC raised three errors. Per base sequence content, per sequence gc content, and sequence duplication levels. I read that this could be because adapters have not been trimmed. I tried using Trimmomatic to trim adapters but I'm not sure that I did it correctly. I used Illuminaclip and tried both TruSeq3 options, I also did slidingwindow averaged bewtween 4 bases with a cutoff score of 20. The sequencing lab sent me a text file of the adapters and I tried cutting and pasting it in as a custom adapter but received an additional sequence length distribution error when I ran the FASTQC. Here's the text file contents: (I removed the > symbols because they were making the post weird but they preceded each "Adapter")

Adaptor1_5p GATCGGAAGAGCACACGTCTGAACTC

Adaptor2_5p AGATCGGAAGAGCGTCGTGTAGGGAA

Adaptor3_5p TTCCCTACACGACGCTCTTCCGATCT

Adaptor4_5p GAGTTCAGACGTGTGCTCTTCCGATC

Adaptor1_3p TTCCCTACACGACGCTCTTCCGATCT

Adaptor2_3p GAGTTCAGACGTGTGCTCTTCCGATC

Adaptor3_3p GATCGGAAGAGCACACGTCTGAACTC

Adaptor4_3p AGATCGGAAGAGCGTCGTGTAGGGAA

TruSeq-Universal_Adapter_5p AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq-Universal_Adapter_3p TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA

Is this dual indexed?

Per base sequence content

Per sequence GC content

Sequence duplication levels

ADD COMMENTlink modified 13 months ago by yztxwd380 • written 13 months ago by mac03pat30

How to add images to a Biostars post

I made the changes for you this time so that images are displayed properly. You have to provide the full link to the image.

ADD REPLYlink written 13 months ago by ATpoint44k

You would find it useful to read several blog posts by authors of FastQC that you can find them here:

https://sequencing.qcfail.com/articles/positional-sequence-bias-in-random-primed-libraries/
https://sequencing.qcfail.com/articles/libraries-can-contain-technical-duplication/

ADD REPLYlink modified 13 months ago • written 13 months ago by GenoMax94k

And the sequence length distribution error is due to the trimmed sequences won't have the same length as those untrimmed.

ADD REPLYlink written 13 months ago by yztxwd380
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1606 users visited in the last hour
_