Question: issue for doing an small rna seq analyzing
0
gravatar for sabaghianamir70
10 months ago by
iran
sabaghianamir7010 wrote:

Hello and merry Christmas

I having trouble for doing an small RNA-seq analyzing So, i align my data with rRNA reference which i downloaded from BioMART.(with Bowtie2) and then took the unaligned reads and map them to my hairpin reference which i downloaded from MirBase(with Bowtie2) and finally get the counts with featureCount(enabled to do not discard multimappers). but at the end i have zero count for DEG step. what should i do ?

rna-seq • 245 views
ADD COMMENTlink modified 9 months ago by Biostar ♦♦ 20 • written 10 months ago by sabaghianamir7010
2

my hairpin reference which i downloaded from MirBase

Did you convert U bases to T before creating your bowtie2 index?

>cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA
>cel-lin-4 MI0000002 Caenorhabditis elegans lin-4 stem-loop
AUGCUUCCGGCCUGUUCCCUGAGACCUCAAGUGUGAGUGUACUAUUGAUGCUUCACACCU
GGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAU

With smallRNA you may want to use bowtie v.1.x since you want ungapped alignments with your short reads.

ADD REPLYlink modified 10 months ago • written 10 months ago by genomax92k

Thanks, I am converting them right now, A side question, So i didnt use Mature MiRNA anywhere. Where we should use mature mirna /?

ADD REPLYlink written 10 months ago by sabaghianamir7010

See: A: Question about miRNAs

ADD REPLYlink written 10 months ago by genomax92k

Do you approve this method ? C: issue for doing an small rna seq analyzing (benformatics said)

ADD REPLYlink modified 10 months ago • written 10 months ago by sabaghianamir7010

Im using bowtie2, also i can use RNA STAR(which is not preferable), and Hisat2. i cant use bowtie v1. is there any other tool which i can use ? in Bowtie2, i did convert to RNA but still no result.

ADD REPLYlink written 10 months ago by sabaghianamir7010

As always in technical debugging question, provide command lines please. Words alone are not sufficient. If you have no results at all odds are good that it is a problem with adequate tool usage but not a problem with the tools itself.

ADD REPLYlink modified 10 months ago • written 10 months ago by ATpoint41k
1

I'm a little confused by why you don't simply align your reads to the entire genome and then use the annotated miRNA locations for your analysis? This should take care of your rRNA reads in addition to the added benefit of removing other small RNA that are derived from the genome (e.g. tRNA, snoRNA, piRNA, etc...); which might otherwise map aberrantly to the hairpins.

ADD REPLYlink modified 10 months ago • written 10 months ago by benformatics2.0k

I did that said, it seems everything is fine, So @ATpoint and @genomax, Do you approve this method ?

ADD REPLYlink written 10 months ago by sabaghianamir7010
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1591 users visited in the last hour