RefSeq/other ID to Gene ID conversion
1
1
Entering edit mode
2.0 years ago

I have a list like:

ID adj.P.Val P.Value logFC SEQUENCE

ASHGA5P025665 2.06e-12 1.35e-16 -6.333.437 CAAGAACAAGACTGGATCACTCCATGTCAGTGGAAACATGTCCACCAACTTCATCATTGT ASHGA5P016911 1.59e-11 2.08e-15 -7.366.312 TTTCTGAAAGGCTCTGCTTTGACCTGAAGTATTTTATCTATCCTCAGTCTCAGGACACTG

This is corresponding a list of genes and I need to obtain the official gene name. I tried DAVID tool and similars, but not successful. How can I obtain the official gene name of a list of 20.000 genes ID's like showed above?

Thanks all.

RNA-Seq gene sequence geneID GeneName • 901 views
ADD COMMENT
0
Entering edit mode

Hi, I have a list of genes like MD00G1000100 and would like to convert it to ENTERZID (103435615) or LOC103435615. I tried DAVID but failed. Is there any other website where I can get it converted? Thank you.

ADD REPLY
0
Entering edit mode

This question is not related to the original parent and should be asked as a separate question. Please indicate where you got these ID's from and what organism they belong to when you create the new question. Then come back and delete this post.

ADD REPLY
0
Entering edit mode
2.0 years ago
dsull ★ 2.5k

This appears to be from Arraystar human lncRNA microarray V3 which contains a mixture of lncRNA and protein-coding genes.

I'm unsure on how to find the official annotation for the lncRNA, but for the protein-coding genes, the NCBI (entrez) gene IDs are located in this file: https://www.ebi.ac.uk/arrayexpress/files/A-MTAB-619/A-MTAB-619.adf.txt

(In that file above, the first column contains the probe ID and the last column contains the gene ID if it's a protein-coding gene).

As for the lncRNA, here are some ideas (hopefully, if someone else has a better alternative, they can chime in):

  1. GENCODE has lncRNA annotations. However, it might take quite a bit of work to map between the sequences provided in your microarray file and the annotations in the GENCODE file. But, in any case, here's the annotation file: ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_19/gencode.v19.long_noncoding_RNAs.gtf.gz
  2. You can do a search for previous studies that have attempted to annotate lncRNA arrays. As an example, see Paul Y, Thomas S, et al., Oncotarget 2018: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6049862/ - Look in the Supplementary Tables which have annotated some of the ArrayStar lncRNAs. (Caveat: I haven't looked at the paper in detail, so I don't know how comprehensive the annotation is nor can I attest to its accuracy, and there are probably several other papers that used the same array and attempted to annotate the lncRNAs.)
ADD COMMENT

Login before adding your answer.

Traffic: 1591 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6