how many bp of barcode and UMI
1
0
Entering edit mode
15 months ago
yueli7 ▴ 210

Hello,

I have data: SRR3196086_1.fastq, SRR3196086_2.fastq.

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE133466

Sequencing was performed on llumina NextSeq 550 machine using a HighOutput flowcell in paired-end mode (R1: 26 cycles; I1: 8 cycles; R2: 57 cycles)

How many bp of barcode and UMI in SRR3196086_1.fastq? The length of it is 28bp, how many bp is barcode, and how many bp is UMI?

Thanks in advance for great help!

Best,

Yue

li@Desktop-590-p0xxx:~/celseq2-master$ head -n 12 SRR9609653_1.fastq 
@SRR9609653.1 1 length=28
GAAGANTAGAGCTTTCTTTGTATTGGTT
+SRR9609653.1 1 length=28
AAAAA#EEEEEEAEEEEEEEEEEEEEEE
@SRR9609653.2 2 length=28
AATCANGAGGAGCAAACCGCGGTTCAGT
+SRR9609653.2 2 length=28
AAAAA#EEEEEEEEEEEEEEEEEEEEEE
@SRR9609653.3 3 length=28
GTCTTNACAAAGCTCTCCTGTTTTCTTG
+SRR9609653.3 3 length=28
/AAA6#A/EEEEEEEEA<E/EEEAAE/E

li@Desktop-590-p0xxx:~/celseq2-master$ head -n 12 SRR9609653_2.fastq 
@SRR9609653.1 1 length=56
CAGAGACTTCGTTTAGCCAAAATTGTGTAGTTTGTGAAAGTGTACAAAAAATCTGN
+SRR9609653.1 1 length=56
AA//AEEEEE/EAA<EEAEE/<E</EA<A/AE<EEEA/AEEEE/6<A<///EEEE#
@SRR9609653.2 2 length=56
ATCTACGAGGCCTGCTTTCTTCTGAATGAGGATTTGGTTTTCCATCGCCTGGTTCN
+SRR9609653.2 2 length=56
AAAAAEEAEA<EAEEE/AEAEEEEEEEA/EEEE<E//EEEE6AEEA/E<E</AA<#
@SRR9609653.3 3 length=56
TATCATTACAGTTTGACTCTGTATAGTCACTACACTCGTTAGCATTGCTGAGTAAN
+SRR9609653.3 3 length=56
AAAA/A/E6E/</A///<EAAA//EE/6<EAEA/6A//EA/E</<//6/<AEEA6#
RNA-Seq • 330 views
ADD COMMENT
3
Entering edit mode
15 months ago
GenoMax 102k
16 bp cell barcodes + 10 bp UMI (V2 chemistry)
16 bp cell barcodes + 12 bp UMI (V3 chemistry)

Looks like you have V3 data.

ADD COMMENT
0
Entering edit mode

Hello, genomax,

Thank you so much for your responding!

Thank you again!

Best,

Yue

ADD REPLY

Login before adding your answer.

Traffic: 941 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6