java.lang.IllegalArgumentException: samples cannot be empty when i run gatk-package- HaplotypeCaller
Entering edit mode
2.6 years ago
zhao03 ▴ 60

hello, when i run gatk, the error always occur, like this "java.lang.IllegalArgumentException: samples cannot be empty" is there mistake in my input file? thank you for your help !

my bam file as following: HWI-EAS418:3:37:1070:1462 83 chr20 46689301 255 50M = 46687222 -2129 CAGCTCCAGGCCGCTCAAGAAGCGGCTGCTCCGCTCCCGGGCTGCGGCCA 0:@2%,6.=:.4=,4+6;B79>=BB=2>7=:9=4(599@BB9BB>BB??A NH:i:1 HI:i:1 AS:i:99 nM:i:0

the script is following: java -jar /home/H/mutation/gatk/gatk-package- HaplotypeCaller -R /home/H/mutation/ref/ctat_genome_lib_build_dir/ref_genome.fa \ -I /home/H/mutation/ctat-mutations-master/testing/__misc_data/Aligned.sortedByCoord.out.GRCh38.bam \ --recover-dangling-heads true \ --dont-use-soft-clipped-bases \ -stand-call-conf 20.0 -O test.vcf

the logs are followinig: Runtime.totalMemory()=2260729856 java.lang.IllegalArgumentException: samples cannot be empty at org.broadinstitute.hellbender.utils.Utils.validateArg( at<init>( at at<init>( at at org.broadinstitute.hellbender.engine.GATKTool.doWork( at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool( at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs( at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain( at org.broadinstitute.hellbender.Main.runCommandLineProgram( at org.broadinstitute.hellbender.Main.mainEntry( at org.broadinstitute.hellbender.Main.main(

snp rna-seq sequencing • 3.3k views
Entering edit mode
10 months ago
omm5177 ▴ 20

I had the same problem, I had to add the read group @RG tag to the .bam file using samtools addreplacerg -r '@RG\tID:samplename\tSM:samplename' input.bam -o output.bam

Entering edit mode
2.6 years ago
zhao03 ▴ 60

What tags of BAM are required ? thank you

Entering edit mode
2.0 years ago
543541656 ▴ 20

hello,have you solved the problem?? I have the same problen as you.

Entering edit mode
11 months ago
soldatsm • 0

Same problem

Entering edit mode
1 day ago
gh • 0

Maybe you used bam file sorted by name in last step.

samtools sort -n bamfile.bam (x)


Login before adding your answer.

Traffic: 2137 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6