Question: java.lang.IllegalArgumentException: samples cannot be empty when i run gatk-package-4.1.4.1-local.jar HaplotypeCaller
0
gravatar for zhao03
6 months ago by
zhao0330
zhao0330 wrote:

hello, when i run gatk, the error always occur, like this "java.lang.IllegalArgumentException: samples cannot be empty" is there mistake in my input file? thank you for your help !

my bam file as following: HWI-EAS418:3:37:1070:1462 83 chr20 46689301 255 50M = 46687222 -2129 CAGCTCCAGGCCGCTCAAGAAGCGGCTGCTCCGCTCCCGGGCTGCGGCCA 0:@2%,6.=:.4=,4+6;B79>=BB=2>7=:9=4(599@BB9BB>BB??A NH:i:1 HI:i:1 AS:i:99 nM:i:0

the script is following: java -jar /home/H/mutation/gatk/gatk-package-4.1.4.1-local.jar HaplotypeCaller -R /home/H/mutation/ref/ctat_genome_lib_build_dir/ref_genome.fa \ -I /home/H/mutation/ctat-mutations-master/testing/__misc_data/Aligned.sortedByCoord.out.GRCh38.bam \ --recover-dangling-heads true \ --dont-use-soft-clipped-bases \ -stand-call-conf 20.0 -O test.vcf

the logs are followinig: Runtime.totalMemory()=2260729856 java.lang.IllegalArgumentException: samples cannot be empty at org.broadinstitute.hellbender.utils.Utils.validateArg(Utils.java:725) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.ReferenceConfidenceModel.<init>(ReferenceConfidenceModel.java:116) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.initialize(HaplotypeCallerEngine.java:221) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.<init>(HaplotypeCallerEngine.java:164) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCaller.onTraversalStart(HaplotypeCaller.java:224) at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1046) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210) at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:163) at org.broadinstitute.hellbender.Main.mainEntry(Main.java:206) at org.broadinstitute.hellbender.Main.main(Main.java:292)

sequencing rna-seq snp • 232 views
ADD COMMENTlink modified 5 days ago by 54354165620 • written 6 months ago by zhao0330
0
gravatar for zhao03
6 months ago by
zhao0330
zhao0330 wrote:

What tags of BAM are required ? thank you

ADD COMMENTlink written 6 months ago by zhao0330
0
gravatar for 543541656
5 days ago by
54354165620
54354165620 wrote:

hello,have you solved the problem?? I have the same problen as you.

ADD COMMENTlink written 5 days ago by 54354165620
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1130 users visited in the last hour