java.lang.IllegalArgumentException: samples cannot be empty when i run gatk-package-4.1.4.1-local.jar HaplotypeCaller
4
3
Entering edit mode
21 months ago
zhao03 ▴ 60

hello, when i run gatk, the error always occur, like this "java.lang.IllegalArgumentException: samples cannot be empty" is there mistake in my input file? thank you for your help !

my bam file as following: HWI-EAS418:3:37:1070:1462 83 chr20 46689301 255 50M = 46687222 -2129 CAGCTCCAGGCCGCTCAAGAAGCGGCTGCTCCGCTCCCGGGCTGCGGCCA 0:@2%,6.=:.4=,4+6;B79>=BB=2>7=:9=4(599@BB9BB>BB??A NH:i:1 HI:i:1 AS:i:99 nM:i:0

the script is following: java -jar /home/H/mutation/gatk/gatk-package-4.1.4.1-local.jar HaplotypeCaller -R /home/H/mutation/ref/ctat_genome_lib_build_dir/ref_genome.fa \ -I /home/H/mutation/ctat-mutations-master/testing/__misc_data/Aligned.sortedByCoord.out.GRCh38.bam \ --recover-dangling-heads true \ --dont-use-soft-clipped-bases \ -stand-call-conf 20.0 -O test.vcf

the logs are followinig: Runtime.totalMemory()=2260729856 java.lang.IllegalArgumentException: samples cannot be empty at org.broadinstitute.hellbender.utils.Utils.validateArg(Utils.java:725) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.ReferenceConfidenceModel.<init>(ReferenceConfidenceModel.java:116) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.initialize(HaplotypeCallerEngine.java:221) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCallerEngine.<init>(HaplotypeCallerEngine.java:164) at org.broadinstitute.hellbender.tools.walkers.haplotypecaller.HaplotypeCaller.onTraversalStart(HaplotypeCaller.java:224) at org.broadinstitute.hellbender.engine.GATKTool.doWork(GATKTool.java:1046) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.runTool(CommandLineProgram.java:139) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMainPostParseArgs(CommandLineProgram.java:191) at org.broadinstitute.hellbender.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:210) at org.broadinstitute.hellbender.Main.runCommandLineProgram(Main.java:163) at org.broadinstitute.hellbender.Main.mainEntry(Main.java:206) at org.broadinstitute.hellbender.Main.main(Main.java:292)

snp rna-seq sequencing • 2.0k views
ADD COMMENT
1
Entering edit mode
4 weeks ago
omm5177 ▴ 10

I had the same problem, I had to add the read group @RG tag to the .bam file using samtools addreplacerg -r '@RG\tID:samplename\tSM:samplename' input.bam -o output.bam

ADD COMMENT
0
Entering edit mode
21 months ago
zhao03 ▴ 60

What tags of BAM are required ? thank you

ADD COMMENT
0
Entering edit mode
14 months ago
543541656 ▴ 20

hello,have you solved the problem?? I have the same problen as you.

ADD COMMENT
0
Entering edit mode
5 weeks ago
soldatsm • 0

Same problem

ADD COMMENT

Login before adding your answer.

Traffic: 1292 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6