Simple Tutorial failing
1
0
Entering edit mode
14 months ago
biodreck • 0

Hi there,

I found this tutorial: https://www.ncbi.nlm.nih.gov/books/NBK52637/

See this figure:

https://www.ncbi.nlm.nih.gov/books/NBK52637/figure/blast_setup_pc.F5/?report=objectonly

The database refseq_rna.00 is installed correctly

When I do this command:

blastdbcmd -db refseq_rna.00 -entry nm_000249 -outfmt "%f" -out test_query.txt

I get the following error:

Error: [blastdbcmd] Entry not found: NM_000249
Error: [blastdbcmd] Entry or entries not found in BLAST database

Apparantly the entry isn't in refseq_rna.00 anymore? How do I know what entries are in my Blast database?

Are there more detailed tutorials about Blast and command line Blast?

Thanks in advance

rna-seq • 227 views
ADD COMMENT
0
Entering edit mode
14 months ago
GenoMax 101k

Note that these steps described above download and install only the first volume of the refseq_rna database. For the complete set, download all the refseq_rna.##.tar.gz files. The database alias file (refseq_rna.nal) in the first volume will tie all volumes back into the complete database

Downloading all files that start with refseq_rna*, decompressing them is best (if you want to use them later).

$ blastdbcmd -db refseq_rna -entry nm_000249 -outfmt "%f" -out test_query.txt
$ more test_query.txt
>NM_000249.4 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA
AGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTCGGCGGCTGGACGAGACAGTGGTGAA
CCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGCTATCAAAGAGATGATTGAGAACTGTTTAGATGCAAAAT
CCACAAGTATTCAAGTGATTGTTAAAGAGGGAGGCCTGAAGTTGATTCAGATCCAAGACAATGGCACCGGGATCAGGAAA

Otherwise it looks like that particular sequence is in chunk 05, if you just want to get that file :

$ blastdbcmd -db refseq_rna.05 -entry nm_000249 -outfmt "%f" -out test_query.txt
ADD COMMENT

Login before adding your answer.

Traffic: 2058 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6