Question: How to extract the pair probabilities from *_dp.ps file using mountain.pl?
0
gravatar for wm
10 months ago by
wm490
China
wm490 wrote:

I have a question about the mountain.pl script:How to extract the pair probabilities from *_dp.ps file using mountain.pl?

According to the descritpion of mountain.pl script: definition of pair probabilities for base i is the mean pair probabilities enclode the base i. But the mountain.pl count the sum instead. This is the reason why mountain.pl failed to process RNAplfold output *_dp.ps.

$ RNAplfold --version 
RNAplfold 2.4.14

$ cat 5S.seq
> 5S rRNA from methanospirillum hungatii
UCAAUAGCGGCCACAGCAGGUGUGUCACACCCGUUCCCAUUCCGAACACGGAAGUUAAGACACCUCACGUGGAUGACGGUACUGAGGUACGCGAGUCCUCGGGAAAUCAUCCUCGCUGCUAUUGUU

$ RNAplfold -W 70 -u 28 < 5S.seq # output files: 5S_dp.ps, 5S_lunp
$ ./ViennaRNA-2.4.14/src/Utils/mountain.pl 5S_dp.ps
Can't take log of -0.036633 at ./ViennaRNA-2.4.14/src/Utils/mountain.pl line 66, <> line 385.

Here are the line report error in mountain.pl:

# line-66 of mountain.pl
$sp[$i] += (1-$pp[$i])*log(abs(1-$pp[$i]));

The description of mountain.pl script:

# produce Pauline Hogeweg's mountain representation *_dp.ps files
# writes 3 sets of x y data separated by a "&"
# the first two sets are mountain representations from base pair probabilities
# and mfe structure, respectively.
# definition: mm[i],mp[i] = (mean) number of base pairs enclosing base i
# third set a measure of well-definedness: the entropy of the pair probs of
# base i, sp[i] = -Sum p_i * ln(p_i). Well-defined regions have low entropy.
secondary structure rna • 173 views
ADD COMMENTlink modified 8 months ago by Biostar ♦♦ 20 • written 10 months ago by wm490
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2537 users visited in the last hour
_