Question: Poly A Sequences In Small Rna
3
gravatar for Ajw
6.5 years ago by
Ajw30
Ajw30 wrote:

Is there a program that can be used to remove sequences with Poly A tail?

illumina analysis mirna data • 3.6k views
ADD COMMENTlink modified 6.4 years ago by Jeremy Leipzig17k • written 6.5 years ago by Ajw30
4
gravatar for Pierre Lindenbaum
6.5 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum95k wrote:

Emboss Trimest: http://emboss.sourceforge.net/apps/cvs/emboss/apps/trimest.html

trimest reads one or more nucleotide sequences and writes them out again but with any 3' poly-A tail (or, optionally, 5' poly-T tail) removed. It detect any poly-A and poly-T tails in the input sequences that are at least the specified minimum length. The tails may continue a defined num of non-A or non-T bases. If both a 5' poly-T tail and a 3' poly-A tail is identified, it removes the longest of the two. The output is a set of sequences with the poly-A (or poly-T) tails removed. If a sequence had a 5' poly-T tail then the resulting sequence is reverse-complemented by default. The description line has a comment appended about the changes made to the sequence.

ADD COMMENTlink written 6.5 years ago by Pierre Lindenbaum95k
0
gravatar for Ning-Yi Shao
6.5 years ago by
Ning-Yi Shao350
United States
Ning-Yi Shao350 wrote:

I am not sure about your question. Do you hope to remove the simple repeats in your dataset? You may try fastxartifactsfilter. It is a command to remove simple artifact sequences in the raw fastaq result of deep sequences.

ADD COMMENTlink written 6.5 years ago by Ning-Yi Shao350

FYI just tried fastx_artifacts_filter, and it did not remove poly-A tails from my reads.

ADD REPLYlink written 6.3 years ago by Doctoroots730
0
gravatar for Shruthi
5.4 years ago by
Shruthi0
Shruthi0 wrote:

prinseq is good too. http://edwards.sdsu.edu/prinseq_beta/#

ADD COMMENTlink written 5.4 years ago by Shruthi0
0
gravatar for Jeremy Leipzig
5.4 years ago by
Philadelphia, PA
Jeremy Leipzig17k wrote:

My limited understanding of the biology suggests that mature mirna will not have polyA tails.

However what I often see in dealing with mature mirna, is an artificial polya . In these cases the polyA will be downstream of the small RNA adapter.

(mature mirna)ATCTCGTATGCCGTCTTCTGCTTG(AAAAAAA)

I originally though this fake polyA was ligated by the illumina small rna kit to piggyback on their mRNA extraction kit, but it is actually Bustard's way of saying "no call" Illumina RNASeq: adaptor sequence followed by polyA?

So while trimming the adapter should also remove the polya, the presence of polya does not imply mRNA contamination. I would focus on using the adapter presence for filtering.

ADD COMMENTlink modified 3.8 years ago • written 5.4 years ago by Jeremy Leipzig17k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 667 users visited in the last hour