How to separate Miseq data and Hiseq data
2
0
Entering edit mode
4.3 years ago
Bioinfo ▴ 20

Hello everyone please i have question i have a file containing Mi seq data and Hi seq data Hi seq reads starts with @HI and Mi seq reads starts with MI. like this for exemple

@HI name
ACATATATATAT
+
HJKSKSKSKSK
@MI name
TCTAGATAGGCTATCAGATGAT
+
HYUHJKKKKKJJJKKKKKKHHYH

my question is how i can separate my seq reads and Hi seq reads .

Thank you

Assembly alignment sequence genome • 811 views
ADD COMMENT
4
Entering edit mode
4.3 years ago
JC 13k

You can use grep command:

grep -A3 "@MI" FILE > miseq_reads.fastq
grep -A3 "@HI" FILE > hiseq_reads.fastq
ADD COMMENT
3
Entering edit mode
4.3 years ago
cschu181 ★ 2.8k
grep -A3 "^@HI" fastq_file | grep -v "\-\-" > hiseq_reads_file
grep -A3 "^@MI" fastq_file | grep -v "\-\-" > miseq_reads_file
ADD COMMENT
0
Entering edit mode

Thank you very much

ADD REPLY
0
Entering edit mode

enter image description here

You can upvote and accept more than one answer.

ADD REPLY

Login before adding your answer.

Traffic: 2990 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6