Order by length sequence
1
0
Entering edit mode
18 months ago
stambukf ▴ 10

Hi everyone.

I want to order a fasta file where i have 35000 sequences with different length in nucleotides. But i don't know how to do it.

Examples:

>contig_1
AAATCGAAACTAGACCATAGC
>contig_2
AAAAAACGTACAGAC
>contig_3
TTTTCGACAAACGAAAACGATTAGCCCAGAC

i want to ordering like this (from shorter to larger length):

>contig_1
AAAAAACGTACAGAC
>contig_2
AAATCGAAACTAGACCATAGC
>contig_3
TTTTCGACAAACGAAAACGATTAGCCCAGAC

I already red another post how to rearrange fasta file according to its length and there is a script but i think that is bad because doesn't run when a ran it.

Please help.

RNA-Seq rna-seq next-gen sequence • 412 views
ADD COMMENT
0
Entering edit mode

You can also use SEDA. The Sort operation (under Choose operation / Reformatting) allows you to order by sequence length.

ADD REPLY
2
Entering edit mode
18 months ago
ATpoint 55k

Please use the search function, this has been adressed before:

how to rearrange fasta file according to its length

How To Filter Multi Fasta By Length??

Order contig by size

ADD COMMENT

Login before adding your answer.

Traffic: 1600 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6