how to map every SNP flanking sequences to a reference genome?
0
0
Entering edit mode
4.1 years ago

Hi to all Good Afternoon I selected some 1000 snps based on MAF, PIC and their coverage in genome based on physical distance. Now i would like to know where and how many places are my SNP flanking sequences match or hit in reference genome? here my goal is to further select snp with only 1 hit, it means it can bind at only one place in genome and will be good results in genotyping. Can i any help me how can i proceed in this process? i did normal NCBI blast but i have more snps to match and it is time taking. Is there any tool or script to make it fast and simple.? any help in this regard is highly appreciated. This is my example snp flanking sequence with [ ] brackets ATGCAATGCATGACGTGCATGCATGCATGCAGTCGCAGTCGTACATGCAGTA and then bracket Thanks in advance

SNP alignment sequence blast • 786 views
ADD COMMENT
0
Entering edit mode

You can use any of the standard NGS aligners to map reads in fasta format to a reference genome such as bowtie2.

ADD REPLY

Login before adding your answer.

Traffic: 2300 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6